NEET (UG) 2024 · previous year paper

NEET (UG) 2024

191 questions with the verified answer key. Open any question for its step-by-step solution.

  1. Question 1Physics· Semiconductor and Electronic Devices

    A logic circuit provides the output YY as per the following truth table :

    ABY
    001
    010
    101
    110

    The expression for the output YY is :

    1. Option A:

      A⋅B+AˉA \cdot B+\bar{A}

    2. Option B:

      A⋅Bˉ+AˉA \cdot \bar{B}+\bar{A}

    3. Option C:

      Bˉ\bar{B}

    4. Option D:

      BB

  2. Question 2Physics· Rotational Dynamics

    A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is vv in the direction shown, which one of the following options is correct ( PP and QQ are any highest and lowest points on the wheel, respectively)?

    Question 2 figure
    1. Option A:

      Point PP moves slower than point QQ

    2. Option B:

      Point PP moves faster than point QQ

    3. Option C:

      Both the points PP and QQ move with equal speed

    4. Option D:

      Point PP has zero speed

  3. Question 3Physics· Capacitors and R-C Circuits

    In the following circuit, the equivalent capacitance between terminal AA and terminal BB is :

    figure

    1. Option A:

      2μ F2 \mu \mathrm{~F}

    2. Option B:

      1μ F1 \mu \mathrm{~F}

    3. Option C:

      0.5μ F0.5 \mu \mathrm{~F}

    4. Option D:

      4μ F4 \mu \mathrm{~F}

  4. Question 4Physics· Work, Power & Energy

    At any instant of time tt, the displacement of any particle is given by 2t−12 t-1 (SI unit) under the influence of force of 5 N . The value of instantaneous power is (in SI unit):

    1. Option A:

      10

    2. Option B:

      5

    3. Option C:

      7

    4. Option D:

      6

  5. Question 5Physics· Electrostatics

    Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R\mathbf{R}.

    Assertion A: The potential (V)(V) at any axial point, at 2 m distance (r)(r) from the centre of the dipole of dipole moment vector P⃗\vec{P} of magnitude, 4×10−6Cm4 \times 10^{-6} \mathrm{C} \mathrm{m}, is ±9×103 V\pm 9 \times 10^{3} \mathrm{~V}.

    (Take 14πϵ0=9×109\frac{1}{4 \pi \epsilon_{0}}=9 \times 10^{9} SI units)

    Reason R: V=±2P4πϵ0r2V= \pm \frac{2 P}{4 \pi \epsilon_{0} r^{2}}, where rr is the distance of any axial point, situated at 2 m from the centre of the dipole.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both AA and RR are true and RR is the correct explanation of AA.

    2. Option B:

      Both A and R are true and R is NOT the correct explanation of A .

    3. Option C:

      AA is true but RR is false.

    4. Option D:

      AA is false but RR is true.

  6. Question 6Physics· System Of Particles

    Two bodies AA and BB of same mass undergo completely inelastic one dimensional collision. The body AA moves with velocity v1v_{1} while body BB is at rest before collision. The velocity of the system after collision is v2v_{2}. The ratio v1:v2v_{1}: v_{2} is

    1. Option A:

      1:21: 2

    2. Option B:

      2:12: 1

    3. Option C:

      4:14: 1

    4. Option D:

      1:41: 4

  7. Question 7Physics· Moving Charges and Magnetic Field

    In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8×10−6 kg m29.8 \times 10^{-6}\ \mathrm{kg\ m^2}. If the magnitude of magnetic moment of the needle is x×10−5 A m2x \times 10^{-5}\ \mathrm{A\ m^2}, then the value of 'x' is:

    Question 7 figure
    1. Option A:

      5π25 \pi^{2}

    2. Option B:

      128π2128 \pi^{2}

    3. Option C:

      50π250 \pi^{2}

    4. Option D:

      1280π21280 \pi^{2}

  8. Question 8Physics· Wave Optics

    An unpolarised light beam strikes a glass surface at Brewster's angle. Then

    1. Option A:

      The reflected light will be partially polarised.

    2. Option B:

      The refracted light will be completely polarised.

    3. Option C:

      Both the reflected and refracted light will be completely polarised.

    4. Option D:

      The reflected light will be completely polarised but the refracted light will be partially polarised.

  9. Question 9Physics· Semiconductor and Electronic Devices

    Consider the following statements AA and BB and identify the correct answer:

    figure

    statement A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

    statement B. In a reverse biased pnp n junction diode, the current measured in (μA)(\mu \mathrm{A}), is due to majority charge carriers.

    In light of the above statements, choose the most appropriate answer from the options given belo

    1. Option A:

      AA is correct but BB is incorrect

    2. Option B:

      AA is incorrect but BB is correct

    3. Option C:

      Both A and B are correct

    4. Option D:

      Both AA and BB are incorrect

  10. Question 10Physics· Atomic Physics

    The graph which shows the variation of (1λ2)\left(\frac{1}{\lambda^{2}}\right) and its kinetic energy, EE is (where λ\lambda is de Broglie wavelength of a free particle):

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  11. Question 11Physics· Current Electricity

    The terminal voltage of the battery, whose emf is 10 V and internal resistance 1Ω1 \Omega, when connected through an external resistance of 4Ω4 \Omega as shown in the figure is:

    figure

    1. Option A:

      4 V

    2. Option B:

      6 V

    3. Option C:

      8 V

    4. Option D:

      10 V

  12. Question 12Physics· Units, Dimensions & Error Analysis

    The quantities which have the same dimensions as those of solid angle are:

    1. Option A:

      strain and angle

    2. Option B:

      stress and angle

    3. Option C:

      strain and arc

    4. Option D:

      angular speed and stress

  13. Question 13Physics· Electromagnetic Induction

    In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

    Question 13 figure
    1. Option A:

      ABA B and DCD C

    2. Option B:

      BAB A and CDC D

    3. Option C:

      ABA B and CDC D

    4. Option D:

      BAB A and DCD C

  14. Question 14Physics· Rotational Dynamics

    The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm22400 \mathrm{~g} \mathrm{~cm}^{2}. The length of the 400 g rod is nearly:

    1. Option A:

      8.5 cm

    2. Option B:

      17.5 cm

    3. Option C:

      20.7 cm

    4. Option D:

      72.0 cm

  15. Question 15Physics· Simple Harmonic Motion

    If x=5sin⁡(πt+π3) mx = 5\sin(\pi t + \frac{\pi}{3})\,\text{m} represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are

    1. Option A:

      5 cm,2 s5 \mathrm{~cm}, 2 \mathrm{~s}

    2. Option B:

      5 m,2 s5 \mathrm{~m}, 2 \mathrm{~s}

    3. Option C:

      5 cm,1 s5 \mathrm{~cm}, 1 \mathrm{~s}

    4. Option D:

      5 m,1 s5 \mathrm{~m}, 1 \mathrm{~s}

  16. Question 16Physics· Gravitation

    The mass of a planet is 110th \frac{1}{10}^{\text {th }} that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

    1. Option A:

      19.6 m s−219.6 \mathrm{~m} \mathrm{~s}^{-2}

    2. Option B:

      9.8 m s−29.8 \mathrm{~m} \mathrm{~s}^{-2}

    3. Option C:

      4.9 m s−24.9 \mathrm{~m} \mathrm{~s}^{-2}

    4. Option D:

      3.92 m s−23.92 \mathrm{~m} \mathrm{~s}^{-2}

  17. Question 17Physics· Newton's Laws of Motion

    A horizontal force 10 N is applied to a block AA as shown in figure. The mass of blocks AA and BB are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block AA on block BB is :

    Question 17 figure
    1. Option A:

      Zero

    2. Option B:

      4 N

    3. Option C:

      6 N

    4. Option D:

      10 N

  18. Question 18Physics· Work, Power & Energy

    A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path b c is:

    Question 18 figure
    1. Option A:

      Zero

    2. Option B:

      30 J

    3. Option C:

      -90 J

    4. Option D:

      -60 J

  19. Question 19Physics· Atomic Physics

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

    Statement II: Atoms of each element are stable and emit their characteristic spectrum.

    In the light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both Statement I and Statement II are correct

    2. Option B:

      Both Statement I and Statement II are incorrect

    3. Option C:

      Statement I is correct but Statement II is incorrect

    4. Option D:

      Statement I is incorrect but Statement II is correct

  20. Question 20Physics· Nuclear Physics

    82290X→αY→e+Z→β−P→e−Q{}^{290}_{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q

    In the nuclear emission stated above, the mass number and atomic number of the product QQ respectively, are

    1. Option A:

      280,81

    2. Option B:

      286,80

    3. Option C:

      288,82

    4. Option D:

      286,81

  21. Question 21Physics· Horizontal Circular Motion

    A particle moving with uniform speed in a circular path maintains:

    1. Option A:

      Constant velocity

    2. Option B:

      Constant acceleration

    3. Option C:

      Constant velocity but varying acceleration

    4. Option D:

      Varying velocity and varying acceleration

  22. Question 22Physics· Geometrical Optics

    A light ray enters through a right angled prism at point PP with the angle of incidence 30∘30^{\circ} as shown in figure. It travels through the prism parallel to its base BCB C and emerges along the face ACA C. The refractive index of the prism is:

    figure

    1. Option A:

      54\frac{\sqrt{5}}{4}

    2. Option B:

      52\frac{\sqrt{5}}{2}

    3. Option C:

      34\frac{\sqrt{3}}{4}

    4. Option D:

      32\frac{\sqrt{3}}{2}

  23. Question 23Physics· Units, Dimensions & Error Analysis

    In a vernier callipers, (N+1)(N+1) divisions of vernier scale coincide with NN divisions of main scale. If 1 MSD represents 0.1 mm , the vernier constant (in cm ) is:

    1. Option A:

      110 N\frac{1}{10 \mathrm{~N}}

    2. Option B:

      1100(N+1)\frac{1}{100(N+1)}

    3. Option C:

      100 N

    4. Option D:

      10(N+1)10(N+1)

  24. Question 24Physics· Wave Optics

    If the monochromatic source in Young's double slit experiment is replaced by white light, then

    1. Option A:

      Interference pattern will disappear

    2. Option B:

      There will be a central dark fringe surrounded by a few coloured fringes

    3. Option C:

      There will be a central bright white fringe surrounded by a few coloured fringes

    4. Option D:

      All bright fringes will be of equal width

  25. Question 25Physics· Atomic Physics

    If cc is the velocity of light in free space, the correct statements about photon among the following are:

    A. The energy of a photon is E=hνE=h \nu.

    B. The velocity of a photon is cc.

    C. The momentum of a photon, p=hvcp=\frac{h v}{c}.

    D. In a photon-electron collision, both total energy and total momentum are conserved.

    E. Photon possesses positive charge.

    Choose the correct answer from the options given below:

    1. Option A:

      A and B only

    2. Option B:

      A, B, C and D only

    3. Option C:

      A, C and D only

    4. Option D:

      A, B, D and E only

  26. Question 26Physics· Semiconductor and Electronic Devices

    The output ( YY ) of the given logic gate is similar to the output of an/a

    figure

    1. Option A:

      NAND gate

    2. Option B:

      NOR gate

    3. Option C:

      OR gate

    4. Option D:

      AND gate

  27. Question 27Physics· Atomic Physics

    Match List I with List II.

    List I (Spectral Lines of Hydrogen for transitions from)List II(Wavelengths (nm))
    A.n2=3{{n}_{2}}=3 to n1=2{{n}_{1}}=2I.410.2
    B.n2=4{{n}_{2}}=4 to n1=2{{n}_{1}}=2II.434.1
    C.n2=5{{n}_{2}}=5 to n1=2{{n}_{1}}=2III.656.3
    D.n2=6{{n}_{2}}=6 to n1=2{{n}_{1}}=2IV.486.1

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-I, C-IV, D-III

    2. Option B:

      A-III, B-IV, C-II, D-I

    3. Option C:

      A-IV, B-III, C-I, D-II

    4. Option D:

      A-I, B-II, C-III, D-IV

  28. Question 28Physics· Mechanical Properties of Matter

    A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m−10.07 \mathrm{~N} \mathrm{~m}^{-1}, then the excess force required to take it away from the surface is

    1. Option A:

      19.8 mN19.8\,\mathrm{mN}

    2. Option B:

      198 N

    3. Option C:

      1.98 mN

    4. Option D:

      99 N

  29. Question 29Physics· Electromagnetic Induction

    In an ideal transformer, the turns ratio is NPNS=12\frac{N_{P}}{N_{S}}=\frac{1}{2}. The ratio VS:VPV_{S}: V_{P} is equal to (the symbols carry their usual meaning) :

    1. Option A:

      1:21: 2

    2. Option B:

      2:12: 1

    3. Option C:

      1:11: 1

    4. Option D:

      1:41: 4

  30. Question 30Physics· Mechanical Properties of Matter

    The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are 8×108 N m−28 \times 10^{8} \mathrm{~N} \mathrm{~m}^{-2} and 2×1011 N m−22 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2}, is:

    1. Option A:

      4 mm

    2. Option B:

      0.4 mm

    3. Option C:

      40 mm

    4. Option D:

      8 mm

  31. Question 31Physics· Electrostatics

    A thin spherical shell is charged by some source. The potential difference between the two points CC and PP (in V ) shown in the figure is:

    (Take 14πε0=9×109\frac{1}{4 \pi \varepsilon_{0}}=9 \times 10^{9} SI units)

    figure

    1. Option A:

      3×1053 \times 10^{5}

    2. Option B:

      1×1051 \times 10^{5}

    3. Option C:

      0.5×1050.5 \times 10^{5}

    4. Option D:

      Zero

  32. Question 32Physics· Current Electricity

    A wire of length ' rr and resistance 100Ω100 \Omega is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

    1. Option A:

      26Ω26 \Omega

    2. Option B:

      52Ω52 \Omega

    3. Option C:

      55Ω55 \Omega

    4. Option D:

      60Ω60 \Omega

  33. Question 33Physics· Moving Charges and Magnetic Field

    A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A . The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4π×10−7SI4 \pi \times 10^{-7} \mathrm{SI} units):

    1. Option A:

      44 mT

    2. Option B:

      4.4 T

    3. Option C:

      4.4 mT

    4. Option D:

      44 T

  34. Question 34Physics· Magnetism and Matter

    Match List-I with List-II.

    List-I (Material)List-II (Susceptibility ( χ\chi ))
    A. DiamagneticI. χ=0\chi =0
    B.FerromagneticII. 0>x≥−10>x\ge -1
    C. ParamagneticIII. χ≫1\chi \gg 1
    D. Non-magneticIV. 0<χ<ε0<\chi <\varepsilon (a small positive number)

    Choose the correct answer from the options given below

    1. Option A:

      A-II, B-III, C-IV, D-I

    2. Option B:

      A-II, B-I, C-III, D-IV

    3. Option C:

      A-III, B-II, C-I, D-IV

    4. Option D:

      A-IV, B-III, C-II, D-I

  35. Question 35Physics· Horizontal Circular Motion

    A bob is whirled in a horizontal plane by means of a string with an initial speed of ω  rpm\omega \mathrm{\;rpm}. The tension in the string is TT. If speed becomes 2ω2 \omega while keeping the same radius, the tension in the string becomes:

    1. Option A:

      TT

    2. Option B:

      4T4 T

    3. Option C:

      T4\frac{T}{4}

    4. Option D:

      2T\sqrt{2} T

  36. Question 36Physics· Electromagnetic Waves

    A parallel plate capacitor is charged by connecting it to a battery through a resistor. If ll is the current in the circuit, then in the gap between the plates:

    1. Option A:

      There is no current

    2. Option B:

      Displacement current of magnitude equal to I flows in the same direction as I

    3. Option C:

      Displacement current of magnitude equal to II flows in a direction opposite to that of II

    4. Option D:

      Displacement current of magnitude greater than / flows but can be in any direction

  37. Question 37Physics· Alternating Current

    A 10μ F10 \mu \mathrm{~F} capacitor is connected to a 210 V,50 Hz210 \mathrm{~V}, 50 \mathrm{~Hz} source as shown in figure. The peak current in the circuit is nearly ( π=3.14\pi=3.14 ):

    figure

    1. Option A:

      0.58 A

    2. Option B:

      1.20 A

    3. Option C:

      0.93 A

    4. Option D:

      0.35 A

  38. Question 38Physics· Simple Harmonic Motion

    If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is x2\frac{x}{2} times its original time period. Then the value of xx is:

    1. Option A:

      3\sqrt{3}

    2. Option B:

      2\sqrt{2}

    3. Option C:

      232 \sqrt{3}

    4. Option D:

      4

  39. Question 39Physics· Kinetic Theory of Gases

    The following graph represents the T−VT-V curves of an ideal gas (where TT is the temperature and VV the volume) at three pressures P1,P2P_{1}, P_{2} and P3P_{3} compared with those of Charles's law represented as dotted lines.

    figure

    Then the correct relation is:

    1. Option A:

      P3>P2>P1P_{3}>P_{2}>P_{1}

    2. Option B:

      P1>P3>P2P_{1}>P_{3}>P_{2}

    3. Option C:

      P2>P1>P3P_{2}>P_{1}>P_{3}

    4. Option D:

      P1>P2>P3P_{1}>P_{2}>P_{3}

  40. Question 40Physics· Gravitation

    The minimum energy required to launch a satellite of mass mm from the surface of earth of mass MM and radius RR in a circular orbit at an altitude of 2R2 R from the surface of the earth is:

    1. Option A:

      5GmM6R\frac{5 G m M}{6 R}

    2. Option B:

      2GmM3R\frac{2 G m M}{3 R}

    3. Option C:

      GmM2R\frac{G m M}{2 R}

    4. Option D:

      GmM3R\frac{G m M}{3 R}

  41. Question 41Physics· Electromagnetic Waves

    The property which is not of an electromagnetic wave travelling in free space is that:

    1. Option A:

      They are transverse in nature

    2. Option B:

      The energy density in electric field is equal to energy density in magnetic field

    3. Option C:

      They travel with a speed equal to 1μ0ε0\frac{1}{\sqrt{\mu_{0} \varepsilon_{0}}}

    4. Option D:

      They originate from charges moving with uniform speed

  42. Question 42Physics· Units, Dimensions & Error Analysis

    A force defined by F=αt2+βtF=\alpha t^{2}+\beta t acts on a particle at a given time tt. The factor which is dimensionless, if α\alpha and β\beta are constants, is:

    1. Option A:

      βt/α\beta t / \alpha

    2. Option B:

      αt/β\alpha t / \beta

    3. Option C:

      αβt\alpha \beta t

    4. Option D:

      αβ/t\alpha \beta / t

  43. Question 43Physics· Current Electricity

    Two heaters AA and BB have power rating of 1 kW and 2 kW , respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

    1. Option A:

      1:11: 1

    2. Option B:

      2:92: 9

    3. Option C:

      1:21: 2

    4. Option D:

      2:32: 3

  44. Question 44Physics· Moving Charges and Magnetic Field

    An iron bar of length LL has magnetic moment MM. It is bent at the middle of its length such that the two arms make an angle 60∘60^{\circ} with each other. The magnetic moment of this new magnet is :

    1. Option A:

      MM

    2. Option B:

      M2\frac{M}{2}

    3. Option C:

      2M2 M

    4. Option D:

      M3\frac{M}{\sqrt{3}}

  45. Question 45Physics· Mechanical Properties of Matter

    A metallic bar of Young's modulus, 0.5×1011 N m−20.5 \times 10^{11} \, \text{N m}^{-2} and coefficient of linear thermal expansion 10−5 °C−110^{-5} \, \text{°C}^{-1}, length 1 m and area of cross-section 10−3 m210^{-3} \, \text{m}^2 is heated from 0∘C0^\circ \text{C} to 100∘C100^\circ \text{C} without expansion or bending. The compressive force developed in it is:

    1. Option A:

      5×103 N5 \times 10^{3} \mathrm{~N}

    2. Option B:

      50×103 N50 \times 10^{3} \mathrm{~N}

    3. Option C:

      100×103 N100 \times 10^{3} \mathrm{~N}

    4. Option D:

      2×103 N2 \times 10^{3} \mathrm{~N}

  46. Question 46Physics· Motion in one Dimension

    The velocity (v)(v) - time (t)(t) plot of the motion of a body is shown below:

    The acceleration (a) - time (t)(t) graph that best suits this motion is :

    Question 46 figure
    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  47. Question 47Physics· Capacitors and R-C Circuits

    If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then

    A. the charge stored in it, increases.

    B. the energy stored in it, decreases.

    C. its capacitance increases.

    D. the ratio of charge to its potential remains the same.

    E. the product of charge and voltage increases.

    Choose the most appropriate answer from the options given below:

    1. Option A:

      A, B and E only

    2. Option B:

      A, C and E only

    3. Option C:

      B, D and E only

    4. Option D:

      A, B and C only

  48. Question 48Physics· Geometrical Optics

    A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm . The magnifying power of telescope for viewing a distant object is:

    1. Option A:

      34

    2. Option B:

      28

    3. Option C:

      17

    4. Option D:

      32

  49. Question 49Physics· Electromagnetic Induction

    A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

    A. hold the sheet there if it is magnetic.

    B. hold the sheet there if it is non-magnetic.

    C. move the sheet away from the pole with uniform velocity if it is conducting.

    D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

    Choose the correct statement(s) from the options given below:

    1. Option A:

      B and D only

    2. Option B:

      A and C only

    3. Option C:

      A, C and D only

    4. Option D:

      C only

  50. Question 50Chemistry· Periodicity of Elements and Periodic Properties

    Arrange the following elements in increasing order of electronegativity:

    N, O, F, C, Si

    Choose the correct answer from the options given below:

    1. Option A:

      Si<C<N<O<F\mathrm{Si}<\mathrm{C}<\mathrm{N}<\mathrm{O}<\mathrm{F}

    2. Option B:

      Si<C<O<N<F\mathrm{Si}<\mathrm{C}<\mathrm{O}<\mathrm{N}<\mathrm{F}

    3. Option C:

      O<F<N<C<Si\mathrm{O}<\mathrm{F}<\mathrm{N}<\mathrm{C}<\mathrm{Si}

    4. Option D:

      F<O<N<C<Si\mathrm{F}<\mathrm{O}<\mathrm{N}<\mathrm{C}<\mathrm{Si}

  51. Question 51Chemistry· Aldehydes and Ketones

    Identify the correct reagents that would bring about the following transformation.

    figure

    1. Option A:

      (i)(i) H2O/H+\mathrm{H}_{2} \mathrm{O} / \mathrm{H}^{+} (ii)(ii) CrO3\mathrm{CrO}_{3}

    2. Option B:

      (i)(i) BH3\mathrm{BH}_{3} (ii)(ii) H2O2/O⊖H\mathrm{H}_{2} \mathrm{O}_{2} / \stackrel{\ominus}{\mathrm{O}} \mathrm{H} (iii)(iii) PCCPCC

    3. Option C:

      (i)(i) BH3\mathrm{BH}_{3} (ii)(ii) H2O2/O⊖H\mathrm{H}_{2} \mathrm{O}_{2} / \stackrel{\ominus}{\mathrm{O}} \mathrm{H} (iii)(iii) alk. \mathrm{KMnO}_{4}$$(iv) H3O⊕\mathrm{H}_{3} \mathrm{O}^{\oplus}

    4. Option D:

      (i)(i) H2O/H+\mathrm{H}_{2} \mathrm{O} / \mathrm{H}^{+} (ii)(ii) PCCPCC

  52. Question 52Chemistry· Alkyl and Aryl Halides

    The compound that will undergo SN1S_{N} 1 reaction with the fastest rate is

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  53. Question 53Chemistry· Chemical Equilibrium

    For the reaction 2 A⇌ B+C,Kc=4×10−32 \mathrm{~A} \rightleftharpoons \mathrm{~B}+\mathrm{C}, \mathrm{K}_{\mathrm{c}}=4 \times 10^{-3}. At a given time, the composition of reaction

    mixture is:

    [A]=[B]=[C]=2×10−3M[A]=[B]=[C]=2 \times 10^{-3} \mathrm{M}.

    Then, which of the following is correct?

    1. Option A:

      Reaction is at equilibrium.

    2. Option B:

      Reaction has a tendency to go in forward direction.

    3. Option C:

      Reaction has a tendency to go in backward direction.

    4. Option D:

      Reaction has gone to completion in forward direction.

  54. Question 54Chemistry· Some Basic Concepts of Chemistry (Mole Concept) + Stoichiometry

    The highest number of helium atoms is present in:

    1. Option A:

      4 mol of helium

    2. Option B:

      4 u of helium

    3. Option C:

      4 g of helium

    4. Option D:

      2.27 L of helium at STP

  55. Question 55Chemistry· Thermodynamics & Thermochemistry

    Match List I with List II.

    List-I (Process)List-II (Conditions)
    A. Isothermal processI. No heat exchange
    B. Isochoric processII. Carried out at constant temperature
    C. Isobaric processIII. Carried out at constant volume
    D. Adiabatic processIV. Carried out at constant pressure

    Choose the correct answer from the options given below:

    1. Option A:

      A-IV, B-III, C-II, D-I

    2. Option B:

      A-IV, B-II, C-III, D-I

    3. Option C:

      A-I, B-II, C-III, D-IV

    4. Option D:

      A-II, B-III, C-IV, D-I

  56. Question 56Chemistry· Structure of Atom

    The energy of an electron in the ground state (n=1)(n=1) for He+\mathrm{He}^{+}ion is −xJ-x J, then that for an electron in n=2n=2 state for Be3+\mathrm{Be}^{3+} ion in J is

    1. Option A:

      −x-x

    2. Option B:

      −x9-\frac{x}{9}

    3. Option C:

      −4x-4 x

    4. Option D:

      −49x-\frac{4}{9} x

  57. Question 57Chemistry· Hydrocarbons

    Match List I with List II.

    List I (Molecule)List II (Number and types of bond/s between two carbon atoms)
    A. ethaneI. one σ\sigma-bond and two π\pi-bonds
    B. etheneII. two π\pi-bonds
    C. carbon molecule, C2C_2III. one σ\sigma-bond
    D. ethyneIV. one σ\sigma-bond and one π\pi-bond

    Choose the correct answer from the options given below:

    1. Option A:

      A-I, B-IV, C-II, D-III

    2. Option B:

      A-IV, B-III, C-II, D-I

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-III, B-IV, C-I, D-II

  58. Question 58Chemistry· Chemical Bonding

    Match List I with List II.

    List I (Compound)List II (Shape/geometry)
    A. NH3_3I. Trigonal Pyramidal
    B. BrF5_5II. Square Planar
    C. XeF4_4III. Octahedral
    D. SF6_6IV. Square Pyramidal

    Choose the correct answer from the options given below:

    1. Option A:

      A-I, B-IV, C-II, D-III

    2. Option B:

      A-II, B-IV, C-III, D-I

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-II, B-III, C-IV, D-I

  59. Question 59Chemistry· d and f Block Elements

    The E∘\mathrm{E}^{\circ} value for the Mn3+/Mn2+\mathrm{Mn}^{3+} / \mathrm{Mn}^{2+} couple is more positive than that of Cr3+/Cr2+\mathrm{Cr}^{3+} / \mathrm{Cr}^{2+} or Fe3+/Fe2+\mathrm{Fe}^{3+} / \mathrm{Fe}^{2+} due to change of

    1. Option A:

      d5d^{5} to d4d^{4} configuration

    2. Option B:

      d5d^{5} to d2d^{2} configuration

    3. Option C:

      d4d^{4} to d5d^{5} configuration

    4. Option D:

      d3d^{3} to d5d^{5} configuration

  60. Question 60Chemistry· Chemical Equilibrium

    In which of the following equilibria, Kp\mathrm{K}_{\mathrm{p}} and Kc\mathrm{K}_{\mathrm{c}} are NOT equal?

    1. Option A:

      PCl5( g)⇌PCl3( g)+Cl2( g)\mathrm{PCl}_{5(\mathrm{~g})} \rightleftharpoons \mathrm{PCl}_{3(\mathrm{~g})}+\mathrm{Cl}_{2(\mathrm{~g})}

    2. Option B:

      H2( g)+I2( g)⇌2HI(g)\mathrm{H}_{2(\mathrm{~g})}+\mathrm{I}_{2(\mathrm{~g})} \rightleftharpoons 2 \mathrm{HI}_{(\mathrm{g})}

    3. Option C:

      CO(g)+H2O(g)⇌CO2( g)+H2( g)\mathrm{CO}_{(\mathrm{g})}+\mathrm{H}_{2} \mathrm{O}_{(\mathrm{g})} \rightleftharpoons \mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_{2(\mathrm{~g})}

    4. Option D:

      2BrCl(g)⇌Br2( g)+Cl2( g)2 \mathrm{BrCl}_{(\mathrm{g})} \rightleftharpoons \mathrm{Br}_{2(\mathrm{~g})}+\mathrm{Cl}_{2(\mathrm{~g})}

  61. Question 61Chemistry· p-Block Elements (Group 15-18)

    Among Group 16 elements, which one does NOT show -2 oxidation state?

    1. Option A:

      OO

    2. Option B:

      SeSe

    3. Option C:

      TeTe

    4. Option D:

      PoPo

  62. Question 62Chemistry· Coordination Compounds

    Spin only' magnetic moment is same for which of the following ions?

    A. Ti3+\mathrm{Ti}^{3+}

    B. Cr2+\mathrm{Cr}^{2+}

    C. Mn2+\mathrm{Mn}^{2+}

    D. Fe2+\mathrm{Fe}^{2+}

    E. Sc3+\mathrm{Sc}^{3+}

    Choose the most appropriate answer from the options given below.

    1. Option A:

      B and D only

    2. Option B:

      A and E only

    3. Option C:

      B and C only

    4. Option D:

      A and D only

  63. Question 63Chemistry· IUPAC Nomenclature

    A compound with a molecular formula of CX6HX14\ce{C6H14} has two tertiary carbons. Its IUPAC name is:

    1. Option A:

      n-hexane

    2. Option B:

      2-methylpentane

    3. Option C:

      2,3-dimethylbutane

    4. Option D:

      2,2-dimethylbutane

  64. Question 64Chemistry· Hydrocarbons

    Given below are two statements:

    Statement I: The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane

    Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are correct

    2. Option B:

      Both Statement I and Statement II are incorrect

    3. Option C:

      Statement I is correct but Statement II is incorrect

    4. Option D:

      Statement I is incorrect but Statement II is correct

  65. Question 65Chemistry· Solutions and Colligative Properties

    The Henry's law constant KHK_H values of three gases (A,B,C)(A, B, C) in water are 145145, 2×10−52 \times 10^{-5} and 35 kbar35\, \text{kbar}, respectively. The solubility of these gases in water follows the order:

    1. Option A:

      B >> A >> C

    2. Option B:

      B >> C >> A

    3. Option C:

      A >> C >> B

    4. Option D:

      A >> B >> C

  66. Question 66Chemistry· Aldehydes and Ketones

    Fehling's solution ' AA ' is

    1. Option A:

      aqueous copper sulphate

    2. Option B:

      alkaline copper sulphate

    3. Option C:

      alkaline solution of sodium potassium tartrate (Rochelle's salt)

    4. Option D:

      aqueous sodium citrate

  67. Question 67Chemistry· p-Block Elements (Group 15-18)

    Given below are two statements:

    Statement I: The boiling point of hydrides of Group 16 elements follow the order

    H2O>H2Te>H2Se>H2 S\mathrm{H}_{2} \mathrm{O}>\mathrm{H}_{2} \mathrm{Te}>\mathrm{H}_{2} \mathrm{Se}>\mathrm{H}_{2} \mathrm{~S}.

    Statement II: On the basis of molecular mass, H2O\mathrm{H}_{2} \mathrm{O} is expected to have lower boiling point than the

    other members of the group but due to the presence of extensive H -bonding in

    H2O\mathrm{H}_{2} \mathrm{O}, it has higher boiling point.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  68. Question 68Chemistry· Coordination Compounds

    Given below are two statements :

    Statement I: Both [Co(NH3)6]3+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} and [CoF]3−[\mathrm{CoF}]^{3-} complexes are octahedral but differ in their magnetic behaviour.

    Statement II: [Co(NH3)6]3+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} is diamagnetic whereas [CoF6]3−\left[\mathrm{CoF}_{6}\right]^{3-} is paramagnetic.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  69. Question 69Chemistry· Solid State

    On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

    1. Option A:

      Crystallization

    2. Option B:

      Sublimation

    3. Option C:

      Distillation

    4. Option D:

      Chromatography

  70. Question 70Chemistry· Coordination Compounds

    Match List I with List II. \section*{List I (Complex)} A.

    List I (Complex)List II (Type of isomerism)
    A. [Co(NH3_3)5_5(NO2_2)]Cl2_2I. Solvate isomerism
    B. [Co(NH3_3)5_5(SO4_4)]BrII. Linkage isomerism
    C. [Co(NH3_3)6_6][Cr(CN)6_6]III. Ionization isomerism
    D. [Co(H2_2O)6_6]Cl3_3IV. Coordination isomerism

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-III, C-IV, D-I

    2. Option B:

      A-I, B-III, C-IV, D-II

    3. Option C:

      A-I, B-IV, C-III, D-II

    4. Option D:

      A-II, B-IV, C-III, D-I

  71. Question 71Chemistry· Biomolecules

    The reagents with which glucose does not react to give the corresponding tests/products are

    A. Tollen's reagent

    B. Schiff's reagent

    C. HCN

    D. NH2OH\mathrm{NH}_{2} \mathrm{OH}

    E. NaHSO3\mathrm{NaHSO}_{3}

    Choose the correct options from the given below:

    1. Option A:

      B and C

    2. Option B:

      A and D

    3. Option C:

      B and E

    4. Option D:

      E and D

  72. Question 72Chemistry· Aromatic Compounds

    Match List I with List II.

    figure

    1. Option A:

      A-IV, B-I, C-III, D-II

    2. Option B:

      A-III, B-I, C-II, D-IV

    3. Option C:

      A-IV, B-I, C-II, D-III

    4. Option D:

      A-I, B-IV, C-II, D-III

  73. Question 73Chemistry· Chemical Kinetics

    Activation energy of any chemical reaction can be calculated if one knows the value of

    1. Option A:

      rate constant at standard temperature

    2. Option B:

      probability of collision

    3. Option C:

      orientation of reactant molecules during collision

    4. Option D:

      rate constant at two different temperatures

  74. Question 74Chemistry· Electrochemistry

    Match List I with List II.

    List I (Conversion)List II (Number of Faraday required)
    A. 1 mol of H2_2O to O2_2I. 3F
    B. 1 mol of MnO4−_4^- to Mn2+^{2+}II. 2F
    C. 1.5 mol of Ca from molten CaCl2_2III. 1F
    D. 1 mol of FeO to Fe2_2O3_3IV. 5F

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-IV, C-I, D-III

    2. Option B:

      A-III, B-IV, C-I, D-II

    3. Option C:

      A-II, B-III, C-I, D-IV

    4. Option D:

      A-III, B-IV, C-II, D-I

  75. Question 75Chemistry· Chemical Bonding

    Intramolecular hydrogen bonding is present in

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:

      HFHF

  76. Question 76Chemistry· Aromatic Compounds

    Given below are two statements:

    Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.

    Statement II : Aniline cannot be prepared through Gabriel synthesis.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is correct but Statement II is false

    4. Option D:

      Statement I is incorrect but Statement II is true

  77. Question 77Chemistry· Alcohols, Ethers and Phenols

    Which one of the following alcohols reacts instantaneously with Lucas reagent?

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
    5. Option E:
      CH3−CH2−CH2−CH2OH\text{CH}_3 - \text{CH}_2 - \text{CH}_2 - \text{CH}_2\text{OH}
    6. Option F:
      CH3−CH2−CH−OH∣CH3\begin{array}{c} \text{CH}_3 - \text{CH}_2 - \text{CH} - \text{OH} \\ \mid \\ \text{CH}_3 \end{array}
    7. Option G:
      CH3−CH−CH2OH∣CH3\begin{array}{c} \text{CH}_3 - \text{CH} - \text{CH}_2\text{OH} \\ \mid \\ \text{CH}_3 \end{array}
    8. Option H:
      CH3∣CH3−C−OH∣CH3\begin{array}{c} \text{CH}_3 \\ \mid \\ \text{CH}_3 - \text{C} - \text{OH} \\ \mid \\ \text{CH}_3 \end{array}
  78. Question 78Chemistry· Periodicity of Elements and Periodic Properties

    Arrange the following elements in increasing order of first ionization enthalpy:

    Li, Be, B, C, N

    Choose the correct answer from the options given below:

    1. Option A:

      Li<Be<B<C<N\mathrm{Li}<\mathrm{Be}<\mathrm{B}<\mathrm{C}<\mathrm{N}

    2. Option B:

      Li<B<Be<C<N\mathrm{Li}<\mathrm{B}<\mathrm{Be}<\mathrm{C}<\mathrm{N}

    3. Option C:

      Li<Be<C<B<N\mathrm{Li}<\mathrm{Be}<\mathrm{C}<\mathrm{B}<\mathrm{N}

    4. Option D:

      Li<Be<N<B<C\mathrm{Li}<\mathrm{Be}<\mathrm{N}<\mathrm{B}<\mathrm{C}

  79. Question 79Chemistry· Redox Reactions

    Which reaction is NOT a redox reaction?

    1. Option A:

      Zn+CuSO4→ZnSO4+Cu\mathrm{Zn}+\mathrm{CuSO}_{4} \rightarrow \mathrm{ZnSO}_{4}+\mathrm{Cu}

    2. Option B:

      2KClO3+I2→2KIO3+Cl22 \mathrm{KClO}_{3}+\mathrm{I}_{2} \rightarrow 2 \mathrm{KIO}_{3}+\mathrm{Cl}_{2}

    3. Option C:

      H2+Cl2→2HCl\mathrm{H}_{2}+\mathrm{Cl}_{2} \rightarrow 2 \mathrm{HCl}

    4. Option D:

      BaCl2+Na2SO4→BaSO4+2NaCl\mathrm{BaCl}_{2}+\mathrm{Na}_{2} \mathrm{SO}_{4} \rightarrow \mathrm{BaSO}_{4}+2 \mathrm{NaCl}

  80. Question 80Chemistry· Structure of Atom

    Match List I with List II

    List I (Quantum Number)List II (Information provided)
    A. mmI. Shape of orbital
    B. m2m_2II. Size of orbital
    C. IIIII. Orientation of orbital
    D. nnIV. Orientation of spin of electron

    Choose the correct answer from the options given below :

    1. Option A:

      A-I, B-III, C-II, D-IV

    2. Option B:

      A-III, B-IV, C-I, D-II

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-II, B-I, C-IV, D-III

  81. Question 81Chemistry· Thermodynamics & Thermochemistry

    In which of the following processes entropy increases?

    A. A liquid evaporates to vapour.

    B. Temperature of a crystalline solid lowered from 130 K to 0 K .

    C. 2NaHCO3( s)→Na2CO3( s)+CO2( g)+H2O(g)2 \mathrm{NaHCO}_{3(\mathrm{~s})} \rightarrow \mathrm{Na}_{2} \mathrm{CO}_{3(\mathrm{~s})}+\mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_{2} \mathrm{O}_{(\mathrm{g})}

    D. Cl2( g)→2Cl(g)\mathrm{Cl}_{2(\mathrm{~g})} \rightarrow 2 \mathrm{Cl}_{(\mathrm{g})}

    Choose the correct answer from the options given below:

    1. Option A:

      A and C

    2. Option B:

      A, B and D

    3. Option C:

      A, C and D

    4. Option D:

      C and D

  82. Question 82Chemistry· Some Basic Concepts of Chemistry (Mole Concept) + Stoichiometry

    1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to

    1. Option A:

      750 mg

    2. Option B:

      250 mg

    3. Option C:

      Zero mg

    4. Option D:

      200 mg

  83. Question 83Chemistry· Alkyl and Aryl Halides

    The products AA and BB obtained in the following reactions, respectively, are

    3ROH+PCl3→3RCl+A3 \mathrm{ROH}+\mathrm{PCl}_{3} \rightarrow 3 \mathrm{RCl}+\mathrm{A}

    ROH+PCl5→RCl+HCl+B\mathrm{ROH}+\mathrm{PCl}_{5} \rightarrow \mathrm{RCl}+\mathrm{HCl}+\mathrm{B}

    1. Option A:

      POCl3\mathrm{POCl}_{3} and H3PO3\mathrm{H}_{3} \mathrm{PO}_{3}

    2. Option B:

      POCl3\mathrm{POCl}_{3} and H3PO4\mathrm{H}_{3} \mathrm{PO}_{4}

    3. Option C:

      H3PO4\mathrm{H}_{3} \mathrm{PO}_{4} and POCl3\mathrm{POCl}_{3}

    4. Option D:

      H3PO3\mathrm{H}_{3} \mathrm{PO}_{3} and POCl3\mathrm{POCl}_{3}

  84. Question 84Chemistry· Nitrogen Containing Organic Compounds

    Identify the major product C formed in the following reaction sequence:

    figure

    1. Option A:

      propylamine

    2. Option B:

      butylamine

    3. Option C:

      butanamide

    4. Option D:

      α\alpha-bromobutanoic acid

  85. Question 85Chemistry· Practical Inorganic chemistry (Qualitative Analysis)

    During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+\mathrm{Fe}^{2+} ion?

    1. Option A:

      dilute hydrochloric acid

    2. Option B:

      concentrated sulphuric acid

    3. Option C:

      dilute nitric acid

    4. Option D:

      dilute sulphuric acid

  86. Question 86Chemistry· Chemical Equilibrium

    Consider the following reaction in a sealed vessel at equilibrium with concentrations of

    N2=3.0×10−3M,O2=4.2×10−3M\mathrm{N}_{2}=3.0 \times 10^{-3} \mathrm{M}, \mathrm{O}_{2}=4.2 \times 10^{-3} \mathrm{M} and NO=2.8×10−3M\mathrm{NO}=2.8 \times 10^{-3} \mathrm{M}.

    2NO(g)⇌N2( g)+O2( g)2 \mathrm{NO}_{(\mathrm{g})} \rightleftharpoons \mathrm{N}_{2(\mathrm{~g})}+\mathrm{O}_{2(\mathrm{~g})}

    If 0.1 mol L−10.1 \mathrm{~mol} \mathrm{~L}^{-1} of NO(g)\mathrm{NO}_{(\mathrm{g})} is taken in a closed vessel, what will be degree of dissociation

    ( α\alpha ) of NO(g)\mathrm{NO}_{(\mathrm{g})} at equilibrium?

    1. Option A:

      0.00889

    2. Option B:

      0.0889

    3. Option C:

      0.8889

    4. Option D:

      0.717

  87. Question 87Chemistry· Thermodynamics & Thermochemistry

    The work done during reversible isothermal expansion of one mole of hydrogen gas at 25∘C25^{\circ} \mathrm{C} from pressure of 20 atmosphere to 10 atmosphere is (Given R=2.0calK−1 mol−1\mathrm{R}=2.0 \mathrm{cal} \mathrm{K}^{-1} \mathrm{~mol}^{-1} )

    1. Option A:

      0 calorie

    2. Option B:
      • 413.14 calories
    3. Option C:

      413.14 calories

    4. Option D:

      100 calories

  88. Question 88Chemistry· Electrochemistry

    Mass in grams of copper deposited by passing 9.6487 A current through a voltameter containing copper sulphate solution for 100 seconds is (Given : Molar mass of Cu:63 g mol−1,1 F=96487 CCu :63\, g\, mol^{-1}, 1\, F =96487\,C )

    1. Option A:

      3.15 g

    2. Option B:

      0.315 g

    3. Option C:

      31.5 g

    4. Option D:

      0.0315 g

  89. Question 89Chemistry· Chemical Kinetics

    The rate of a reaction quadruples when temperature changes from 27∘C27^{\circ} \mathrm{C} to 57∘C57^{\circ} \mathrm{C}. Calculate the energy of activation.

    Given R=8.314 J K−1 mol−1,log⁡4=0.6021\mathrm{R}=8.314 \mathrm{~J} \mathrm{~K}^{-1} \mathrm{~mol}^{-1}, \log 4=0.6021

    1. Option A:

      38.04 kJ mol−138.04\ \mathrm{kJ\ mol^{-1}}

    2. Option B:

      380.4 kJ mol−1380.4\ \mathrm{kJ\ mol^{-1}}

    3. Option C:

      3.80 kJ mol−13.80\ \mathrm{kJ\ mol^{-1}}

    4. Option D:

      3804 kJ mol−13804\ \mathrm{kJ\ mol^{-1}}

  90. Question 90Chemistry· Solutions and Colligative Properties

    The plot of osmotic pressure ( Π\Pi ) vs concentration ( molL−1\mathrm{mol} \mathrm{L}^{-1} ) for a solution gives a straight line with slope 25.73 Lbarmol−125.73 \mathrm{~L} \mathrm{bar} \mathrm{mol}^{-1}. The temperature at which the osmotic pressure measurement is done is (Use R =0.083 L=0.083 \mathrm{~L} bar mol−1 K−1\mathrm{mol}^{-1} \mathrm{~K}^{-1} )

    1. Option A:

      37∘C37^{\circ} \mathrm{C}

    2. Option B:

      310∘C310^{\circ} \mathrm{C}

    3. Option C:

      25.73∘C25.73^{\circ} \mathrm{C}

    4. Option D:

      12.05∘C12.05^{\circ} \mathrm{C}

  91. Question 91Chemistry· Practical Inorganic chemistry (Qualitative Analysis)

    Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI .

    A. Al3+\mathrm{Al}^{3+}

    B. Cu2+\mathrm{Cu}^{2+}

    C. Ba2+\mathrm{Ba}^{2+}

    D. Co2+\mathrm{Co}^{2+}

    E. Mg2+\mathrm{Mg}^{2+}

    Choose the correct answer from the options given below.

    1. Option A:

      B,A,D,C,EB, A, D, C, E

    2. Option B:

      B,C,A,D,EB, C, A, D, E

    3. Option C:

      E,C,D,B,AE, C, D, B, A

    4. Option D:

      E,A,B,C,DE, A, B, C, D

  92. Question 92Chemistry· Coordination Compounds

    Given below are two statements :

    Statement I: [Co(NH3)6]3+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} is a homoleptic complex whereas [Co(NH3)4Cl2]+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{4} \mathrm{Cl}_{2}\right]^{+}is a heteroleptic complex.

    Statement II : Complex [Co(NH3)6]3+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]^{3+} has only one kind of ligands but [Co(NH3)4Cl2]+\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{4} \mathrm{Cl}_{2}\right]^{+}has more than one kind of ligands.

    In the light of the above statements, choose the correct answer from the options given below.

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  93. Question 93Chemistry· d and f Block Elements

    The pair of lanthanoid ions which are diamagnetic is

    1. Option A:

      CeX4+\ce{Ce^{4+}} and YbX2+\ce{Yb^{2+}}

    2. Option B:

      CeX3+\ce{Ce^{3+}} and EuX2+\ce{Eu^{2+}}

    3. Option C:

      GdX3+\ce{Gd^{3+}} and EuX3+\ce{Eu^{3+}}

    4. Option D:

      PmX3+\ce{Pm^{3+}} and SmX3+\ce{Sm^{3+}}

  94. Question 94Chemistry· Carboxylic Acids and Derivatives

    For the given reaction:

    figure

    ‘P’ is

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  95. Question 95Chemistry· Chemical Bonding

    Identify the correct answer.

    1. Option A:

      Three resonance structures can be drawn for ozone

    2. Option B:

      BF3\mathrm{BF}_{3} has non-zero dipole moment

    3. Option C:

      Dipole moment of NF3\mathrm{NF}_{3} is greater than that of NH3\mathrm{NH}_{3}

    4. Option D:

      Three canonical forms can be drawn for CO32−\mathrm{CO}_{3}^{2-} ion

  96. Question 96Chemistry· Some Basic Concepts of Chemistry (Mole Concept) + Stoichiometry

    A compound XX contains 32%32 \% of A,20%A, 20 \% of BB and remaining percentage of CC. Then, the empirical

    formula of XX is : (Given atomic masses of A=64;B=40;C=32uA=64 ; B=40 ; C=32 u )

    1. Option A:

      A2BC2\mathrm{A}_{2} \mathrm{BC}_{2}

    2. Option B:

      ABC3\mathrm{ABC}_{3}

    3. Option C:

      AB2C2\mathrm{AB}_{2} \mathrm{C}_{2}

    4. Option D:

      ABC4\mathrm{ABC}_{4}

  97. Question 97Botany· Biological Classification

    Match List I with List II

    List-IList-II
    A.RhizopusI.Mushroom
    B.UstilagoII.Smut fungus
    C.PucciniaIII.Bread mould
    D.AgaricusIV.Rust fungus

    Choose the correct answer from the options given below:

    1. Option A:

      A-III, B-II, C-IV, D-I

    2. Option B:

      A-I, B-III, C-II, D-IV

    3. Option C:

      A-III, B-II, C-I, D-IV

    4. Option D:

      A-IV, B-III, C-II, D-I

  98. Question 98Botany· Morphology of Flowering Plants

    Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

    Question 98 figure
    1. Option A:

      A

    2. Option B:

      B

    3. Option C:

      C

    4. Option D:

      D

  99. Question 99Zoology· Biomolecules

    Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

    1. Option A:

      Amino acids

    2. Option B:

      Phospholipids

    3. Option C:

      Glycerides

    4. Option D:

      Carbohydrates

  100. Question 100Botany· Principles of Inheritance and Variation

    Match List-I with List-II.

    List IList II
    A. Two or more alternative forms of a geneI. Back cross
    B. Cross of F1F_1 progeny with homozygous recessive parentII. Ploidy
    C. Cross of F1F_1 progeny with any of the parentsIII. Allele
    D. Number of chromosome sets in plantD. Number of chromosome sets in plant

    Choose the correct answer from the options given below

    1. Option A:

      A-I, B-II, C-III, D-IV

    2. Option B:

      A-II, B-I, C-III, D-IV

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-IV, B-III, C-II, D-I

  101. Question 101Botany· Molecular basis of Inheritance

    A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

    1. Option A:

      Repressor, Operator gene, Structural gene

    2. Option B:

      Structural gene, Transposons, Operator gene

    3. Option C:

      Inducer, Repressor, Structural gene

    4. Option D:

      Promotor, Structural gene, Terminator

  102. Question 102Botany· Plant Growth and Development

    Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

    1. Option A:

      promotes apical dominance.

    2. Option B:

      promotes abscission of mature leaves only.

    3. Option C:

      does not affect mature monocotyledonous plants.

    4. Option D:

      can help in cell division in grasses, to produce growth.

  103. Question 103Botany· Biodiversity and Conservation

    These are regarded as major causes of biodiversity loss:

    A. Over exploitation

    B. Co-extinction

    C. Mutation

    D. Habitat loss and fragmentation E. Migration

    Choose the correct option:

    1. Option A:

      A, C and D only

    2. Option B:

      A, B, C and D only

    3. Option C:

      A, B and E only

    4. Option D:

      A, B and D only

  104. Question 104Botany· Microbes in Human Welfare

    Match List I with List II List I A.

    List IList II
    A. Clostridium butylicumI. Ethanol
    B. Saccharomyces cerevisiaeII. Streptokinase
    C. Trichoderma polysporumIII. Butyric acid
    D. Streptococcus sp.IV. Cyclosporin-A

    Choose the correct answer from the options given below:

    1. Option A:

      A-III, B-I, C-II, D-IV

    2. Option B:

      A-II, B-IV, C-III, D-I

    3. Option C:

      A-III, B-I, C-IV, D-II

    4. Option D:

      A-IV, B-I, C-III, D-II

  105. Question 105Botany· Cell Cycle and Cell Division

    Spindle fibers attach to kinetochores of chromosomes during

    1. Option A:

      Prophase

    2. Option B:

      Metaphase

    3. Option C:

      Anaphase

    4. Option D:

      Telophase

  106. Question 106Botany· Morphology of Flowering Plants

    Which of the following is an example of actinomorphic flower?

    1. Option A:

      Datura

    2. Option B:

      Cassia

    3. Option C:

      Pisum

    4. Option D:

      Sesbania

  107. Question 107Zoology· Biomolecules

    The cofactor of the enzyme carboxypeptidase is:

    1. Option A:

      Zinc

    2. Option B:

      Niacin

    3. Option C:

      Flavin

    4. Option D:

      Haem

  108. Question 108Botany· Cell: The Unit of Life

    Match List-I with List-II.

    List-IList-II
    A.NucleolusI.Site of formation of glycolipid
    B.CentrioleII.Organization like the cartwheel
    C.LeucoplastsIII.Site for active ribosomal RNA synthesis
    D.Golgi apparatusIV.For storing nutrients

    Choose the correct answer from the options given below

    1. Option A:

      A-III, B-II, C-IV, D-I

    2. Option B:

      A-II, B-III, C-I, D-IV

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-I, B-II, C-III, D-IV

  109. Question 109Botany· Biotechnology

    The capacity to generate a whole plant from any cell of the plant is called:

    1. Option A:

      Totipotency

    2. Option B:

      Micropropagation

    3. Option C:

      Differentiation

    4. Option D:

      Somatic hybridization

  110. Question 110Botany· Molecular basis of Inheritance

    Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

    1. Option A:

      8 bp

    2. Option B:

      6 bp

    3. Option C:

      4 bp

    4. Option D:

      10 bp

  111. Question 111Botany· Sexual Reproduction in Flowering Plants

    Identify the set of correct statements:

    A. The flowers of Vallisneria are colourful and produce nectar.

    B. The flowers of water lily are not pollinated by water.

    C. In most of water-pollinated species, the pollen grains are protected from wetting.

    D. Pollen grains of some hydrophytes are long and ribbon like.

    E. In some hydrophytes, the pollen grains are carried passively inside water.

    Choose the correct answer from the options given below.

    1. Option A:

      C, D and E only

    2. Option B:

      A, B, C and D only

    3. Option C:

      A, C, D and E only

    4. Option D:

      B, C, D and E only

  112. Question 112Botany· Anatomy of Flowering Plants

    Given below are two statements:

    Statement I: Parenchyma is living but collenchyma is dead tissue.

    Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  113. Question 113Botany· Plant Growth and Development

    Formation of interfascicular cambium from fully developed parenchyma cells is an example for

    1. Option A:

      Differentiation

    2. Option B:

      Redifferentiation

    3. Option C:

      Dedifferentiation

    4. Option D:

      Maturation

  114. Question 114Zoology· Biomolecules

    Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

    1. Option A:

      Cofactor inhibition

    2. Option B:

      Feedback inhibition

    3. Option C:

      Competitive inhibition

    4. Option D:

      Enzyme activation

  115. Question 115Botany· Morphology of Flowering Plants

    Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

    figure

    1. Option A:

      (a) Epigynous; (b) Hypogynous

    2. Option B:

      (a) Hypogynous; (b) Epigynous

    3. Option C:

      (a) Perigynous; (b) Epigynous

    4. Option D:

      (a) Perigynous; (b) Perigynous

  116. Question 116Botany· Principles of Inheritance and Variation

    In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

    1. Option A:

      BBBB

    2. Option B:

      bbbb

    3. Option C:

      BbBb

    4. Option D:

      BB/Bb\mathrm{BB} / \mathrm{Bb}

  117. Question 117Botany· Biodiversity and Conservation

    Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable.

    Choose the correct answer from the options given below.

    1. Option A:

      A, C, D and E only

    2. Option B:

      A and B only

    3. Option C:

      A, B and E only

    4. Option D:

      A, B and D only

  118. Question 118Botany· Organisms and Populations

    The equation of Verhulst-Pearl logistic growth is dNdt=rN[K−NK]\frac{d N}{d t}=r N\left[\frac{K-N}{K}\right].

    From this equation, K indicates:

    1. Option A:

      Intrinsic rate of natural increase

    2. Option B:

      Biotic potential

    3. Option C:

      Carrying capacity

    4. Option D:

      Population density

  119. Question 119Botany· Anatomy of Flowering Plants

    In the given figure, which component has thin outer walls and highly thickened inner walls?

    figure

    1. Option A:

      C

    2. Option B:

      D

    3. Option C:

      A

    4. Option D:

      B

  120. Question 120Botany· Cell Cycle and Cell Division

    Given below are two statements:

    Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.

    Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  121. Question 121Botany· Biodiversity and Conservation

    List of endangered species was released by

    1. Option A:

      GEAC

    2. Option B:

      WWF

    3. Option C:

      FOAM

    4. Option D:

      IUCN

  122. Question 122Zoology· Biotechnology: Principles and Processes

    What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

    A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

    B. It may get integrated into the genome of the recipient.

    C. It may multiply and be inherited along with the host DNA.

    D. The alien piece of DNA is not an integral part of chromosome.

    E. It shows ability to replicate.

    Choose the correct answer from the options given below:

    1. Option A:

      A and B only

    2. Option B:

      D and E only

    3. Option C:

      B and C only

    4. Option D:

      A and E only

  123. Question 123Botany· Molecular basis of Inheritance

    The lactose present in the growth medium of bacteria is transported to the cell by the action of

    1. Option A:

      Beta-galactosidase

    2. Option B:

      Acetylase

    3. Option C:

      Permease

    4. Option D:

      Polymerase

  124. Question 124Botany· Principles of Inheritance and Variation

    Which one of the following can be explained on the basis of Mendel's Law of Dominance?

    A. Out of one pair of factors one is dominant and the other is recessive.

    B. Alleles do not show any expression and both the characters appear as such in F2F_{2} generation.

    C. Factors occur in pairs in normal diploid plants.

    D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross.

    Choose the correct answer from the options given below:

    1. Option A:

      A, B and C only

    2. Option B:

      A, C, D and E only

    3. Option C:

      B, C and D only

    4. Option D:

      A, B, C, D and E

  125. Question 125Botany· Biological Classification

    Which one of the following is not a critericriteria for classification of fungi?

    1. Option A:

      Morphology of mycelium

    2. Option B:

      Mode of nutrition

    3. Option C:

      Mode of spore formation

    4. Option D:

      Fruiting body

  126. Question 126Zoology· Biotechnology and its Applications

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.

    Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  127. Question 127Botany· Anatomy of Flowering Plants

    Bulliform cells are responsible for

    1. Option A:

      Inward curling of leaves in monocots.

    2. Option B:

      Protecting the plant from salt stress.

    3. Option C:

      Increased photosynthesis in monocots.

    4. Option D:

      Providing large spaces for storage of sugars.

  128. Question 128Botany· Principles of Inheritance and Variation

    A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

    1. Option A:

      Only red flowered plants

    2. Option B:

      Red flowered as well as pink flowered plants

    3. Option C:

      Only pink flowered plants

    4. Option D:

      Red, Pink as well as white flowered plants

  129. Question 129Botany· Photosynthesis in Higher Plants

    How many molecules of ATP and NADPH are required for every molecule of CO2\mathrm{CO}_{2} fixed in the Calvin

    cycle?

    1. Option A:

      2 molecules of ATP and 3 molecules of NADPH

    2. Option B:

      2 molecules of ATP and 2 molecules of NADPH

    3. Option C:

      3 molecules of ATP and 3 molecules of NADPH

    4. Option D:

      3 molecules of ATP and 2 molecules of NADPH

  130. Question 130Botany· Biodiversity and Conservation

    Match List I with List II

    List IList II
    A. Robert MayI. Species-Area relationship
    B. Alexander von HumboldtII. Long term ecosystem experiment using out door plots
    C. Paul EhrlichIII. Global species diversity at about 7 million
    D. David TilmanIV. Rivet popper hypothesis

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-III, C-I, D-IV

    2. Option B:

      A-III, B-I, C-IV, D-II

    3. Option C:

      A-I, B-III, C-II, D-IV

    4. Option D:

      A-III, B-IV, C-II, D-I

  131. Question 131Botany· Molecular basis of Inheritance

    Match List I with List II

    List IList II
    A. Frederick GriffithI. Genetic code
    B. Francois Jacob & Jacque MonodII. Semi-conservative mode of DNA replication
    C. Har Gobind KhoranaIII. Transformation
    D. Meselson & StahlIV. Lac operon

    Choose the correct answer from the options given below:

    1. Option A:

      A-III, B-II, C-I, D-IV

    2. Option B:

      A-III, B-IV, C-I, D-II

    3. Option C:

      A-II, B-III, C-IV, D-I

    4. Option D:

      A-IV, B-I, C-II, D-III

  132. Question 132Botany· Plant Growth and Development

    Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

    1. Option A:

      Auxin

    2. Option B:

      Gibberellin

    3. Option C:

      Cytokinin

    4. Option D:

      Abscisic acid

  133. Question 133Botany· Morphology of Flowering Plants

    Match List I with List II

    List IList II
    A. RoseI. Twisted aestivation
    B. PeaII. Perigynous flower
    C. CottonIII. Drupe
    D. MangoIV. Marginal placentation

    Choose the correct answer from the options given below :

    1. Option A:

      A−II,B−IV,C−I,D−IIIA-II, B-IV, C-I, D-III

    2. Option B:

      A−I,B−II,C−III,D−IVA-I, B-I I, C-I I I, D-I V

    3. Option C:

      A−IV,B−III,C−II,D−IA-IV, B-III, C-II, D-I

    4. Option D:

      A−II,B−III,C−IV,D−IA-II, B-III, C-IV, D-I

  134. Question 134Botany· Plant Kingdom

    Read the following statements and choose the set of correct statements:

    In the members of Phaeophyceae,

    A. Asexual reproduction occurs usually by biflagellate zoospores.

    B. Sexual reproduction is by oogamous method only.

    C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

    D. The major pigments found are chlorophyll a,c\mathrm{a}, \mathrm{c} and carotenoids and xanthophyll.

    E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

    1. Option A:

      A , B, C and D only

    2. Option B:

      B, C, D and E only

    3. Option C:

      A, C, D and E only

    4. Option D:

      A, B, C and E only

  135. Question 135Botany· Respiration in Plants

    Identify the step in the tricarboxylic acid cycle which does not involve oxidation of substrate.

    1. Option A:

      Malic acid →\rightarrow Oxaloacetic acid

    2. Option B:

      Succinic acid →\rightarrow Fumaric acid →\rightarrow Malic acid

    3. Option C:

      Succinyl-CoA →\rightarrow Succinic acid

    4. Option D:

      Isocitrate →α\rightarrow \alpha-ketoglutaric acid

  136. Question 136Botany· Photosynthesis in Higher Plants

    Given below are two statements: one is labelled as Statement I and the other is labelled as Statement II.

    Statement I: In C3C_3 plants, some OX2\ce{O2} binds to RuBisCO, hence COX2\ce{CO2} fixation is decreased.

    Statement II: In C4C_4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  137. Question 137Zoology· Biomolecules

    Match List-I with List-II

    List-IList-II
    A. GLUT-4I. Hormone
    B. InsulinII. Enzyme
    C. TrypsinIII. Intercellular ground substance
    D. CollagenIV. Enables glucose transport into cells

    Choose the correct answer from the options given below.

    1. Option A:

      A-IV, B-I, C-II, D-III

    2. Option B:

      A-I, B-II, C-III, D-IV

    3. Option C:

      A-II, B-III, C-IV, D-I

    4. Option D:

      A-III, B-IV, C-I, D-II

  138. Question 138Botany· Morphology of Flowering Plants

    Match List I with List II

    List I (Types of Stamens)List II (Example)
    A. MonoadelphousI. Citrus
    B. DiadelphousII. Pea
    C. PolyadelphousIII. Lily
    D. EpiphyllousIV. China-rose

    Choose the correct answer from the options given below:

    1. Option A:

      A-IV, B-II, C-I, D-III

    2. Option B:

      A-IV, B-I, C-II, D-III

    3. Option C:

      A-I, B-II, C-IV, D-III

    4. Option D:

      A-III, B-I, C-IV, D-II

  139. Question 139Botany· Cell: The Unit of Life

    The DNA present in chloroplast is:

    1. Option A:

      Linear, double stranded

    2. Option B:

      Circular, double stranded

    3. Option C:

      Linear, single stranded

    4. Option D:

      Circular, single stranded

  140. Question 140Botany· Biotechnology

    Which of the following are fused in somatic hybridization involving two varieties of plants?

    1. Option A:

      Callus

    2. Option B:

      Somatic embryos

    3. Option C:

      Protoplasts

    4. Option D:

      Pollens

  141. Question 141Botany· Respiration in Plants

    Match List-I with List-II.

    List IList II
    A.Citric acid cycleI.Cytoplasm
    B.GlycolysisII.Mitochondrial matrix
    C.Electron transport systemIII.Intermembrane space of mitochondria
    D.Proton gradientIV.Inner mitochondrial membrane

    Choose the correct answer from the options given below

    1. Option A:

      A-I, B-II, C-III, D-IV

    2. Option B:

      A-II, B-I, C-IV, D-III

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-IV, B-III, C-II, D-I

  142. Question 142Botany· Molecular basis of Inheritance

    Which of the following statement is correct regarding the process of replication in E.coli?

    1. Option A:

      The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3′→5′3^{\prime} \rightarrow 5^{\prime}

    2. Option B:

      The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5′→3′5^{\prime} \rightarrow 3^{\prime}

    3. Option C:

      The DNA dependent DNA polymerase catalyses polymerization in 5′→3′5^{\prime} \rightarrow 3^{\prime} as well as 3′→5′3^{\prime} \rightarrow 5^{\prime} direction

    4. Option D:

      The DNA dependent DNA polymerase catalyses polymerization in 5′→3′5^{\prime} \rightarrow 3^{\prime} direction

  143. Question 143Zoology· Chemical Control and Coordination

    Which of the following is not a steroid hormone?

    1. Option A:

      Cortisol

    2. Option B:

      Testosterone

    3. Option C:

      Progesterone

    4. Option D:

      Glucagon

  144. Question 144Zoology· Human Reproduction

    Given below are two statements: one is labelled as Statement I and the other is labelled as Statement II:

    Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

    Statement II: The hymen is torn during the first coitus only.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  145. Question 145Zoology· Biotechnology: Principles and Processes

    Which of the following statements is incorrect?

    1. Option A:

      A bio-reactor provides optimal growth conditions for achieving the desired product

    2. Option B:

      Most commonly used bio-reactors are of stirring type

    3. Option C:

      Bio-reactors are used to produce small scale bacterial cultures

    4. Option D:

      Bio-reactors have an agitator system, an oxygen delivery system and foam control system

  146. Question 146Botany· Molecular basis of Inheritance

    Which one is the correct product of DNA dependent RNA polymerase to the given template?

    3'TACATGGCAAATATCCATTCA5'

    1. Option A:

      5'AUGUACCGUUUAUAGGUAAGU3'

    2. Option B:

      5'AUGUAAAGUUUAUAGGUAAGU3'

    3. Option C:

      5'AUGUACCGUUUAUAGGGAAGU3'

    4. Option D:

      5'ATGTACCGTTTATAGGTAAGT3'

  147. Question 147Zoology· Chemical Control and Coordination

    Given below are two statements : one is labelled as Assertion AA and the other is labelled as Reason RR :

    Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.

    Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      Both AA and RR are true and RR is the correct explanation of AA

    2. Option B:

      Both AA and RR are true but RR is NOT the correct explanation of AA

    3. Option C:

      AA is true but RR is false

    4. Option D:

      AA is false but RR is true

  148. Question 148Zoology· Human Health and Diseases

    Match List-I with List-II.

    List IList II
    A.TyphoidI.Fungus
    B.LeishmaniasisII.Nematode
    C.RingwormIII.Protozoa
    D.FilariasisIV.Bacteria

    Choose the correct answer from the options given below

    1. Option A:

      A-I, B-III, C-II, D-IV

    2. Option B:

      A-IV, B-III, C-I, D-II

    3. Option C:

      A-III, B-I, C-IV, D-II

    4. Option D:

      A-II, B-IV, C-III, D-I

  149. Question 149Zoology· Body Fluids and Circulation

    Following are the stages of pathway for conduction of an action potential through the heart

    A. AV bundle

    B. Purkinje fibres

    C. AV node

    D. Bundle branches

    E. SA node

    Choose the correct sequence of pathway from the options given below

    1. Option A:

      E-C-A-D-B

    2. Option B:

      A-E-C-B-D

    3. Option C:

      B-D-E-C-A

    4. Option D:

      E-A-D-B-C

  150. Question 150Zoology· Human Reproduction

    Match List I with List II :

    List I (Sub Phases of Prophase I)List II (Specific Characters)
    A.DiakinesisI.Synaptonemal complex formation
    B.PachyteneII.Completion of terminalisation of chiasmata
    C.ZygoteneIII.Chromosomes look like thin threads
    D.LeptoteneIV.Appearance of recombination nodules

    Choose the correct answer from the options given below

    1. Option A:

      A-IV, B-II, C-III, D-I

    2. Option B:

      A-I, B-II, C-IV, D-III

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-IV, B-III, C-II, D-I

  151. Question 151Zoology· Locomotion and Movement

    Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

    figure

    Name of muscle/location

    1. Option A:

      (a) Smooth - Toes(b) Skeletal - Legs(c) Cardiac - Heart

    2. Option B:

      (a) Skeletal - Triceps(b) Smooth - Stomach(c) Cardiac - Heart

    3. Option C:

      (a) Skeletal - Biceps(b) Involuntary - Intestine(c) Smooth - Heart

    4. Option D:

      (a) Involuntary - Nose tip(b) Skeletal - Bone(c) Cardiac - Heart

  152. Question 152Zoology· Reproductive Health

    Match List-I with List-II.

    List IList II
    A.Non-medicated IUDI.Multiload 375
    B.Copper releasing IUDII.Progestogens
    C.Hormone releasing IUDIII.Lippes loop
    D.ImplantsIV.LNG-20

    Choose the correct answer from the options given below

    1. Option A:

      A-III, B-I, C-II, D-IV

    2. Option B:

      A-I, B-III, C-IV, D-II

    3. Option C:

      A-IV, B-I, C-II, D-III

    4. Option D:

      A-III, B-I, C-IV, D-II

  153. Question 153Zoology· Biomolecules

    Match List-I with List-II.

    List-IList-II
    A.LipaseI.Peptide bond
    B.NucleaseII.Ester bond
    C.ProteaseIII.Glycosidic bond
    D.AmylaseIV.Phosphodiester bond

    Choose the correct answer from the options given below

    1. Option A:

      A-IV, B-II, C-III, D-I

    2. Option B:

      A-III, B-II, C-I, D-IV

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-IV, B-I, C-III, D-II

  154. Question 154Zoology· Human Health and Diseases

    Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R.

    Assertion A: Breast-feeding during the initial period of infant growth is recommended by doctors for a healthy baby.

    Reason R: Colostrum contains several antibodies absolutely essential to develop resistance in the newborn baby.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both A and R are correct and R is the correct explanation of A

    2. Option B:

      Both A and R are correct but R is NOT the correct explanation of A

    3. Option C:

      A is correct but R is not correct

    4. Option D:

      A is not correct but R is correct

  155. Question 155Zoology· Evolution

    Given below are some stages of human evolution.

    Arrange them in correct sequence. (Past to Recent)

    A. Homo habilis

    B. Homo sapiens

    C. Homo neanderthalensis

    D. Homo erectus

    Choose the correct sequence of human evolution from the options given below:

    1. Option A:

      D-A-C-B

    2. Option B:

      B-A-D-C

    3. Option C:

      C-B-D-A

    4. Option D:

      A-D-C-B

  156. Question 156Zoology· Human Health and Diseases

    Match List I with List II :

    List IList II
    A. AxonemeI. Centriole
    B. Cartwheel patternII. Cilia and flagella
    C. CristaIII. Chromosome
    D. SatelliteIV. Mitochondria

    Choose the correct answer from the options given below :

    1. Option A:

      A-IV, B-III, C-II, D-I

    2. Option B:

      A-IV, B-II, C-III, D-I

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-II, B-I, C-IV, D-III

  157. Question 157Zoology· Animal Kingdom

    Match List I with List II :

    List IList II
    A. PterophyllumI. Hag fish
    B. MyxineII. Saw fish
    C. PristisIII. Angel fish
    D. ExocoetusIV. Flying fish

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-I, C-III, D-IV

    2. Option B:

      A-III, B-I, C-II, D-IV

    3. Option C:

      A-IV, B-I, C-II, D-III

    4. Option D:

      A-III, B-II, C-I, D-IV

  158. Question 158Zoology· Biotechnology and its Applications

    Match List I with List II :

    List IList II
    A. α−1\alpha - 1 antitrypsinI. Cotton bollworm
    B. Cry IAbII. ADA deficiency
    C. Cry IAcIII. Emphysema
    D Enzyme replacement therapyIV Corn borer

    Choose the correct answer form the options given below:

    1. Option A:

      A-II, B-I, C-IV, D-III

    2. Option B:

      A-III, B-I, C-II, D-IV

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-II, B-IV, C-I, D-III

  159. Question 159Zoology· Biotechnology: Principles and Processes

    The "Ti plasmid" of Agrobacterium tumefaciens stands for

    1. Option A:

      Tumour inhibiting plasmid

    2. Option B:

      Tumor independent plasmid

    3. Option C:

      Tumor inducing plasmid

    4. Option D:

      Temperature independent plasmid

  160. Question 160Zoology· Animal Kingdom

    Match List I with List II :

    List IList II
    A.PleurobrachiaI.Mollusca
    B.RadulaII.Ctenophora
    C.StomochordIII.Osteichthyes
    D.Air bladderIV.Hemichordata

    Choose the correct answer from the options given below :

    1. Option A:

      A-IV, B-II, C-III, D-I

    2. Option B:

      A-II, B-I, C-IV, D-III

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-IV, B-III, C-II, D-I

  161. Question 161Zoology· Reproductive Health

    Which of the following is not a natural/traditional contraceptive method?

    1. Option A:

      Coitus interruptus

    2. Option B:

      Periodic abstinence

    3. Option C:

      Lactational amenorrhea

    4. Option D:

      Vaults

  162. Question 162Botany· Cell Cycle and Cell Division

    Following are the stages of cell division :

    A. Gap 2 phase

    B. Cytokinesis

    C. Synthesis phase

    D. Karyokinesis

    E. Gap 1 phase

    Choose the correct sequence of stages from the options given below :

    1. Option A:

      C-E-D-A-B

    2. Option B:

      E-B-D-A-C

    3. Option C:

      B-D-E-A-C

    4. Option D:

      E-C-A-D-B

  163. Question 163Zoology· Evolution

    Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

    1. Option A:

      Genetic recombination

    2. Option B:

      Genetic drift

    3. Option C:

      Gene migration

    4. Option D:

      Constant gene pool

  164. Question 164Zoology· Neural Control and Coordination

    Match List I with List II

    List IList II
    A.PonsI.Provides additional space for Neurons, regulates posture and balance.
    B.HypothalamusII.Controls respiration and gastric secretions.
    C.MedullaIII.Connects different regions of the brain.
    D.CerebellumIV.Neuro secretory cells

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-III, C-I, D-IV

    2. Option B:

      A-III, B-IV, C-II, D-I

    3. Option C:

      A-I, B-III, C-II, D-IV

    4. Option D:

      A-II, B-I, C-III, D-IV

  165. Question 165Zoology· Breathing and Exchange of Gases

    Match List I with List II :

    List IList II
    A.Expiratory capacityI.Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
    B.Functional residual capacityII.Tidal volume + Expiratory reserve volume
    C.Vital capacityIII.Tidal volume + Inspiratory reserve volume
    D.Inspiratory capacityIV.Expiratory reserve volume + Residual volume

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-IV, C-I, D-III

    2. Option B:

      A-III, B-II, C-IV, D-I

    3. Option C:

      A-II, B-I, C-IV, D-III

    4. Option D:

      A-I, B-III, C-II, D-IV

  166. Question 166Zoology· Human Health and Diseases

    Which of the following are Autoimmune disorders?

    A. Myasthenia gravis

    B. Rheumatoid arthritis

    C. Gout

    D. Muscular dystrophy

    E. Systemic Lupus Erythematosus (SLE)

    Choose the most appropriate answer from the options given below:

    1. Option A:

      A, B & D only

    2. Option B:

      A, B & E only

    3. Option C:

      B, C & E only

    4. Option D:

      C, D & E only

  167. Question 167Zoology· Human Reproduction

    Which of the following is not a component of Fallopian tube?

    1. Option A:

      Uterine fundus

    2. Option B:

      Isthmus

    3. Option C:

      Infundibulum

    4. Option D:

      Ampulla

  168. Question 168Zoology· Locomotion and Movement

    Match List I with List II :

    List IList II
    A.Fibrous jointsI.Adjacent vertebrae, limited movement
    B.Cartilaginous jointsII.Humerus and Pectoral girdle, rotational movement
    C.Hinge jointsIII.Skull, don't allow any movement
    D.Ball and socket jointsIV.Knee, help in locomotion

    Choose the correct answer from the options given below :

    1. Option A:

      A-IV, B-II, C-III, D-I

    2. Option B:

      A-I, B-III, C-II, D-IV

    3. Option C:

      A-II, B-III, C-I, D-IV

    4. Option D:

      A-III, B-I, C-IV, D-II

  169. Question 169Zoology· Locomotion and Movement

    The flippers of the Penguins and Dolphins are the example of the

    1. Option A:

      Adaptive radiation

    2. Option B:

      Natural selection

    3. Option C:

      Convergent evolution

    4. Option D:

      Divergent evolution

  170. Question 170Zoology· Reproductive Health

    Given below are two statements :

    Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

    Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

    In the light of the above statements, choose the correct answer from the option given below :

    1. Option A:

      Both Statement I and Statement II are true

    2. Option B:

      Both Statement I and Statement II are false

    3. Option C:

      Statement I is true but Statement II is false

    4. Option D:

      Statement I is false but Statement II is true

  171. Question 171Zoology· Structural Organisation in Animals

    In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

    1. Option A:

      5th 5^{\text {th }} segment

    2. Option B:

      10th 10^{\text {th }} segment

    3. Option C:

      8th 8^{\text {th }} and 9th 9^{\text {th }} segment

    4. Option D:

      11th 11^{\text {th }} segment

  172. Question 172Zoology· Breathing and Exchange of Gases

    Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

    1. Option A:

      High pO2pO_2 and high pCO2pCO_2

    2. Option B:

      High pO2pO_2 and lower H+H^+ concentration

    3. Option C:

      Low pCO2pCO_2 and high H+H^+ concentration

    4. Option D:

      Low pCO2pCO_2 and high temperature

  173. Question 173Zoology· Biotechnology: Principles and Processes

    The following diagram showing restriction sites in EE. coli cloning vector pBR322p B R 322. Find the role of ' XX and ' YY genes:

    figure

    1. Option A:

      The gene ' XX ' is responsible for resistance to antibiotics and ' YY for protein involved in the replication of Plasmid.

    2. Option B:

      The gene ' XX ' is responsible for controlling the copy number of the linked DNA and ' YY for protein involved in the replication of Plasmid.

    3. Option C:

      The gene ' XX ' is for protein involved in replication of Plasmid and ' YY for resistance to antibiotics.

    4. Option D:

      Gene ' XX ' is responsible for recognitions sites and ' YY ' is responsible for antibiotic resistance.

  174. Question 174Botany· Principles of Inheritance and Variation

    Match List I with List II :

    List IList II
    A.Down's syndromeI.11th  ⁣ ⁣  ⁣ ⁣ {{11}^{\text{th }\!\!~\!\!\text{ }}} chromosome
    B.α\alpha -ThalassemiaII.' X′{X}' chromosome
    C.β\beta -ThalassemiaIII.21st  ⁣ ⁣  ⁣ ⁣ {{21}^{\text{st }\!\!~\!\!\text{ }}} chromosome
    D.Klinefelter's syndromeIV.16th  ⁣ ⁣  ⁣ ⁣ {{16}^{\text{th }\!\!~\!\!\text{ }}} chromosome

    Choose the correct answer from the options given below :

    1. Option A:

      A-I, B-II, C-III, D-IV

    2. Option B:

      A-II, B-III, C-IV, D-I

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-IV, B-I, C-II, D-III

  175. Question 175Zoology· Animal Kingdom

    Consider the following statements :

    A. Annelids are true coelomates

    B. Poriferans are pseudocoelomates

    C. Aschelminthes are acoelomates

    D. Platyhelminthes are pseudocoelomates

    Choose the correct answer from the options given below :

    1. Option A:

      B only

    2. Option B:

      A only

    3. Option C:

      C only

    4. Option D:

      D only

  176. Question 176Zoology· Human Health and Diseases

    Match List I with List II :

    List IList II
    A. Common coldI. Plasmodium
    B. HaemozoinII. Typhoid
    C. Widal testIII. Rhinoviruses
    D. AllergyIV. Dust mites

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-IV, C-III, D-I

    2. Option B:

      A-I, B-III, C-II, D-IV

    3. Option C:

      A-III, B-I, C-II, D-IV

    4. Option D:

      A-IV, B-II, C-III, D-I

  177. Question 177Zoology· Human Health and Diseases

    Match List I with List II :

    List IList II
    A.CocaineI.Effective sedative in surgery
    B.HeroinII.Cannabis sativa
    C.MorphineIII.Erythroxylum
    D.MarijuanaIV.Papaver somniferum

    Choose the correct answer from the options given below:

    1. Option A:

      A-IV, B-III, C-I, D-II

    2. Option B:

      A-I, B-III, C-II, D-IV

    3. Option C:

      A-II, B-I, C-III, D-IV

    4. Option D:

      A-III, B-IV, C-I, D-II

  178. Question 178Zoology· Biomolecules

    Given below are two statements:

    Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

    Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      Both Statement I and Statement II are true.

    2. Option B:

      Both Statement I and Statement II are false.

    3. Option C:

      Statement I is true but Statement II is false.

    4. Option D:

      Statement I is false but Statement II is true.

  179. Question 179Zoology· Animal Kingdom

    The following are the statements about non-chordates:

    A. Pharynx is perforated by gill slits.

    B. Notochord is absent.

    C. Central nervous system is dorsal.

    D. Heart is dorsal if present. E. Post anal tail is absent.

    Choose the most appropriate answer from the options given below:

    1. Option A:

      A & C only

    2. Option B:

      A, B & D only

    3. Option C:

      B, D & E only

    4. Option D:

      B, C & D only

  180. Question 180Zoology· Neural Control and Coordination

    Given below are two statements:

    Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

    Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are correct.

    2. Option B:

      Both Statement I and Statement II are incorrect.

    3. Option C:

      Statement I is correct but Statement II is incorrect.

    4. Option D:

      Statement I is incorrect but Statement II is correct.

  181. Question 181Zoology· Structural Organisation in Animals

    Match List I with List II related to digestive system of cockroach.

    List IList II
    A.The structures used for storing of foodI.Gizzard
    B.Ring of 6-8 blind tubules at junction of foregut and midgut.II.Gastric Caeca
    C.Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut.III.Malpighian tubules
    D.The structures used for grinding the food.IV.Crop

    Choose the correct answer from the options given below:

    1. Option A:

      A-IV, B-II, C-III, D-I

    2. Option B:

      A-I, B-II, C-III, D-IV

    3. Option C:

      A-IV, B-III, C-II, D-I

    4. Option D:

      A-III, B-II, C-IV, D-I

  182. Question 182Zoology· Chemical Control and Coordination

    Match List I with List II :

    List IList II
    A.Exophthalmic goiterI.Excess secretion of cortisol, moon face & hypergylcemia.
    B.AcromegalyII.Hypo-secretion of thyroid hormone and stunted growth.
    C.Cushing's syndromeIII.Hyper secretion of thyroid hormone & protruding eye balls.
    D.CretinismIV.Excessive secretion of growth hormone.

    Choose the correct answer from the options given below :

    1. Option A:

      A-I, B-III, C-II, D-IV

    2. Option B:

      A-IV, B-II, C-I, D-III

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-III, B-IV, C-I, D-II

  183. Question 183Zoology· Chemical Control and Coordination

    Choose the correct statement given below regarding juxta medullary nephron.

    1. Option A:

      Juxta medullary nephrons are located in the columns of Bertini.

    2. Option B:

      Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

    3. Option C:

      Loop of Henle of juxta medullary nephron runs deep into medulla.

    4. Option D:

      Juxta medullary nephrons outnumber the cortical nephrons.

  184. Question 184Zoology· Biomolecules

    Regarding catalytic cycle of an enzyme action, select the correct sequential steps :

    A. Substrate enzyme complex formation.

    B. Free enzyme ready to bind with another substrate.

    C. Release of products.

    D. Chemical bonds of the substrate broken.

    E. Substrate binding to active site.

    Choose the correct answer from the options given below :

    1. Option A:

      E,A,D,C,BE, A, D, C, B

    2. Option B:

      A,E,B,D,CA, E, B, D, C

    3. Option C:

      B, A, C, D, E

    4. Option D:

      E,D,C,B,AE, D, C, B, A

  185. Question 185Zoology· Structural Organisation in Animals

    Match List I with List II:

    List IList II
    A.Unicellular glandular epitheliumI.Salivary glands
    B.Compound epitheliumII.Pancreas
    C.Multicellular glandular epitheliumIII.Goblet cells of alimentary canal
    D.Endocrine glandular epitheliumIV.Moist surface of buccal cavity

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-I, C-III, D-IV

    2. Option B:

      A-IV, B-III, C-I, D-II

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-II, B-I, C-IV, D-III

  186. Question 186Zoology· Evolution

    Match List I with List II:

    List IList II
    A.Mesozoic EraI.Lower invertebrates
    B.Proterozoic EraII.Fish & Amphibia
    C.Cenozoic EraIII.Birds & Reptiles
    D.Paleozoic EraIV.Mammals

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-I, C-III, D-IV

    2. Option B:

      A-III, B-I, C-II, D-IV

    3. Option C:

      A-I, B-II, C-IV, D-III

    4. Option D:

      A-III, B-I, C-IV, D-II

  187. Question 187Zoology· Reproductive Health

    Given below are two statements:

    Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

    Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.

    In the light of the above statements, choose the mis appropriate answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are correct.

    2. Option B:

      Both Statement I and Statement II are incorrect.

    3. Option C:

      Statement I is correct but Statement II is incorrect.

    4. Option D:

      Statement I is incorrect but Statement II is correct.

  188. Question 188Zoology· Body Fluids and Circulation

    Match List I with List II :

    List IList II
    A.P waveI.Heart muscles are electrically silent.
    B.QRS complexII.Depolarisation of ventricles.
    C.T waveIII.Depolarisation of atria.
    D.T-P gapIV.Repolarisation of ventricles.

    Choose the correct answer from the options given below :

    1. Option A:

      A-I, B-III, C-IV, D-II

    2. Option B:

      A-III, B-II, C-IV, D-I

    3. Option C:

      A-II, B-III, C-I, D-IV

    4. Option D:

      A-IV, B-II, C-I, D-III

  189. Question 189Zoology· Human Reproduction

    Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

    figure

    1. Option A:

      FSH, Leydig cells, Sertoli cells, spermiogenesis.

    2. Option B:

      ICSH, Interstitial cells, Leydig cells, spermiogenesis.

    3. Option C:

      FSH, Sertoli cells, Leydig cells, spermatogenesis.

    4. Option D:

      ICSH, Leydig cells, Sertoli cells, spermatogenesis.

  190. Question 190Zoology· Body Fluids and Circulation

    As per ABOA B O blood grouping system, the blood group of father is B+\mathrm{B}^{+}, mother is A+\mathrm{A}^{+}and child is O+\mathrm{O}^{+}. Their respective genotype can be

    A. ∣Bii/Ai/ii\mid \mathrm{Bi}_{\mathrm{i}} / \mathrm{A}_{\mathrm{i}} / \mathrm{ii}

    B. ∣B∣B//∣A∣A/ii\quad|B|^{B /} /\left.\left.\right|^{A}\right|^{A} / i i

    C. AABB/IA/∣BBA^{\mathrm{A}} \mathrm{B}^{\mathrm{B}} / \mathrm{I}^{\mathrm{A}} /\left.\right|^{\mathrm{B}} \mathrm{B}

    D. ∣Ai/Bi//Ai\mid \mathrm{A}_{\mathrm{i}} / \mathrm{B}_{\mathrm{i}} / / \mathrm{A}_{\mathrm{i}}

    E. iiB/iA/∣A∣B\quad i i^{B} / i^{A} /\left.\left.\right|^{A}\right|^{B}

    Choose the most appropriate answer from the options given below :

    1. Option A:

      A only

    2. Option B:

      B only

    3. Option C:

      C & B only

    4. Option D:

      D & E only

  191. Question 191Botany· Molecular basis of Inheritance

    Match List I with List II:

    List IList II
    A.RNA polymerase IIII.snRNPs
    B.Termination of transcriptionII.Promotor
    C.Splicing of ExonsIII.Rho factor
    D.TATA boxIV.SnRNAs, tRNA

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-IV, C-I, D-III

    2. Option B:

      A-III, B-II, C-IV, D-I

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-IV, B-III, C-I, D-II

Stuck on one of these?

Practise questions like them — free, with a tutor that explains every step.

NEET (UG) 2024 — Questions with Answer Key & Solutions · DhiX AI