Botany · Molecular basis of Inheritance
NEET (UG) 2024 — Question 101
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Option A:
Repressor, Operator gene, Structural gene
- Option B:
Structural gene, Transposons, Operator gene
- Option C:
Inducer, Repressor, Structural gene
- Option D:Correct
Promotor, Structural gene, Terminator
Answer: D
Step-by-step solution
A transcription unit of DNA is defined primarily by the three regions in the DNA:
(i) A promoter
(ii) The structural gene
(iii) A terminator
The promoter is said to be located towards -end (upstream) of the structural gene (the reference
is made with respect to the polarity of coding strand)
The terminator is located towards -end (downstream) of the coding strand.
Answer key and solution verified before publishing.
Practise Molecular basis of Inheritance
Start with this question, then two more from the same chapter — with a tutor that explains every step. Free.
- Exam
- NEET (UG) 2024
- Paper
- 2024 paper
- Subject
- Botany
- Chapter
- Molecular basis of Inheritance
- Topic
- Transcription
More Molecular basis of Inheritance questions from this paper
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- The lactose present in the growth medium of bacteria is transported to the cell by the action of
- Match List I with List II List I List II --- --- A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque Monod II.…
- Which of the following statement is correct regarding the process of replication in E.coli?
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'