Botany · Molecular basis of Inheritance
NEET (UG) 2024 — Question 110
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- Option A:
8 bp
- Option B:Correct
6 bp
- Option C:
4 bp
- Option D:
10 bp
Answer: B
Step-by-step solution
The correct answer is option (2).
The first restriction endonuclease - Hind II, whose functioning
depends on a specific DNA nucleotide sequence was isolated. It was found that Hind II always cut DNA
molecules at a particular point by recognising sequence of six base pairs.
Option (1), (3) and (4) are incorrect because they have either more than 6 or less than 6 bp .
Answer key and solution verified before publishing.
Practise Molecular basis of Inheritance
Start with this question, then two more from the same chapter — with a tutor that explains every step. Free.
- Exam
- NEET (UG) 2024
- Paper
- 2024 paper
- Subject
- Botany
- Chapter
- Molecular basis of Inheritance
- Topic
- Replication
More Molecular basis of Inheritance questions from this paper
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- The lactose present in the growth medium of bacteria is transported to the cell by the action of
- Match List I with List II List I List II --- --- A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque Monod II.…
- Which of the following statement is correct regarding the process of replication in E.coli?
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'