Botany · Molecular basis of Inheritance
NEET (UG) 2024 — Question 123
The lactose present in the growth medium of bacteria is transported to the cell by the action of
- Option A:
Beta-galactosidase
- Option B:
Acetylase
- Option C:Correct
Permease
- Option D:
Polymerase
Answer: C
Step-by-step solution
The gene lac operon codes for permease enzyme, which increase the permeability of cell to
-galactosides. So, the lactose present in the growth medium of bacteria is transported into the
cell by the action of permease.
Answer key and solution verified before publishing.
Practise Molecular basis of Inheritance
Start with this question, then two more from the same chapter — with a tutor that explains every step. Free.
- Exam
- NEET (UG) 2024
- Paper
- 2024 paper
- Subject
- Botany
- Chapter
- Molecular basis of Inheritance
- Topic
- Regulation of Gene Expression
More Molecular basis of Inheritance questions from this paper
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- Match List I with List II List I List II --- --- A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque Monod II.…
- Which of the following statement is correct regarding the process of replication in E.coli?
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'