Botany · Molecular basis of Inheritance
NEET (UG) 2024 — Question 142
Which of the following statement is correct regarding the process of replication in E.coli?
- Option A:
The DNA dependent DNA polymerase catalyses polymerization in one direction that is
- Option B:
The DNA dependent RNA polymerase catalyses polymerization in one direction, that is
- Option C:
The DNA dependent DNA polymerase catalyses polymerization in as well as direction
- Option D:Correct
The DNA dependent DNA polymerase catalyses polymerization in direction
Answer: D
Step-by-step solution
In Prokaryotes, like E.coli during replication, the DNA dependent DNA polymerase catalyse polymerization only in one direction, that is
Answer key and solution verified before publishing.
Practise Molecular basis of Inheritance
Start with this question, then two more from the same chapter — with a tutor that explains every step. Free.
- Exam
- NEET (UG) 2024
- Paper
- 2024 paper
- Subject
- Botany
- Chapter
- Molecular basis of Inheritance
- Topic
- Replication
More Molecular basis of Inheritance questions from this paper
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- The lactose present in the growth medium of bacteria is transported to the cell by the action of
- Match List I with List II List I List II --- --- A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque Monod II.…
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'