Botany · Molecular basis of Inheritance
NEET (UG) 2024 — Question 146
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
- Option A:Correct
5'AUGUACCGUUUAUAGGUAAGU3'
- Option B:
5'AUGUAAAGUUUAUAGGUAAGU3'
- Option C:
5'AUGUACCGUUUAUAGGGAAGU3'
- Option D:
5'ATGTACCGTTTATAGGTAAGT3'
Answer: A
Step-by-step solution
Template DNA is :
3'TACATGGCAAATATCCATTCA5'
5'AUGUACCGUUUAUAGGUAAGU3' m-RNA
Answer key and solution verified before publishing.
Practise Molecular basis of Inheritance
Start with this question, then two more from the same chapter — with a tutor that explains every step. Free.
- Exam
- NEET (UG) 2024
- Paper
- 2024 paper
- Subject
- Botany
- Chapter
- Molecular basis of Inheritance
- Topic
- Transcription
More Molecular basis of Inheritance questions from this paper
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
- The lactose present in the growth medium of bacteria is transported to the cell by the action of
- Match List I with List II List I List II --- --- A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque Monod II.…
- Which of the following statement is correct regarding the process of replication in E.coli?