NEET (UG) 2023 · previous year paper
NEET (UG) 2023
185 questions with the verified answer key. Open any question for its step-by-step solution.
- Question 1Physics· Rotational Dynamics
The ratio of radius of gyration of a solid sphere of mass and radius about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 2Physics· Atomic Physics
The work functions of Caesium (Cs), Potassium ( K ) and Sodium ( Na ) are 2.14 eV , 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV , which of these photosensitive surfaces may emit photoelectrons?
- Option A:
Both Na and K
- Option B:
K only
- Option C:
Na only
- Option D:
Cs only
Answer: DStep-by-step solution → - Question 3Physics· Mechanical Properties of Matter
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 4Physics· Units, Dimensions & Error Analysis
Resistance of a carbon resistor determined from colour codes is . The colour of third band must be :
- Option A:
Green
- Option B:
Orange
- Option C:
Yellow
- Option D:
Red
Answer: BStep-by-step solution → - Question 5Physics· Alternating Current
In a series circuit, the inductance is 10 mH , capacitance is and resistance is . The frequency at which resonance occurs is :
- Option A:
15.9 kHz
- Option B:
- Option C:
1.59 kHz
- Option D:
15.9
Answer: CStep-by-step solution → - Question 6Physics· Electromagnetic Waves
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of and amplitude . Then the amplitude of oscillating magnetic field is : (Speed of light in free space )
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 7Physics· Semiconductor and Electronic Devices
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: DStep-by-step solution → - Question 8Physics· Units, Dimensions & Error Analysis
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
- Option A:
Personal errors
- Option B:
Least count errors
- Option C:
Random errors
- Option D:
Instrumental errors
Answer: CStep-by-step solution → - Question 9Physics· Electrostatics
If over a surface, then :
- Option A:
the magnitude of electric field on the surface is constant.
- Option B:
all the charges must necessarily be inside the surface.
- Option C:
the electric field inside the surface is necessarily uniform.
- Option D:
the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
Answer: DStep-by-step solution → - Question 10Physics· Current Electricity
If the galvanometer does not show any deflection in the circuit shown, the value of is given by :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 11Physics· Electromagnetic Waves
An ac source is connected to a capacitor . Due to decrease in its operating frequency :
- Option A:
displacement current increases
- Option B:
displacement current decreases
- Option C:
capacitive reactanceremains constant
- Option D:
Capacitive reactance decreases
Answer: BStep-by-step solution → - Question 12Physics· Atomic Physics
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 13Physics· Fluid Mechanics
The venturi-meter works on :
- Option A:
Bernoulli's principle
- Option B:
The principle of parallel axes
- Option C:
The principle of perpendicular axes
- Option D:
Huygen's principle
Answer: AStep-by-step solution → - Question 14Physics· Units, Dimensions & Error Analysis
A metal wire has mass , radius and length . The maximum possible percentage error in the measurement of density will nearly be:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 15Physics· Wave Optics
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: BStep-by-step solution → - Question 16Physics· Work, Power & Energy
The potential energy of a long spring when stretched by 2 cm is . If the spring is stretched by 8 cm , potential energy stored in it will be :
- Option A:
4 U
- Option B:
8 U
- Option C:
16 U
- Option D:
2 U
Answer: CStep-by-step solution → - Question 17Physics· Geometrical Optics
Light travels a distance in time in air and in time in another denser medium. What is the critical angle for this medium?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 18Physics· Electromagnetic Induction
A lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V . Assuming the transformer to be ideal, what is the current in the primary winding?
- Option A:
2.7 A
- Option B:
3.7 A
- Option C:
0.37 A
- Option D:
0.27 A
Answer: DStep-by-step solution → - Question 19Physics· Motion in Plane
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
- Option A:
along northward
- Option B:
along north-east
- Option C:
along south-west
- Option D:
along eastward
Answer: BStep-by-step solution → - Question 20Physics· Rotational Dynamics
The angular acceleration of a body, moving along the circumference of a circle, is :
- Option A:
along the radius towards the centre
- Option B:
along the tangent to its position
- Option C:
along the axis of rotation
- Option D:
along the radius, away from centre
Answer: CStep-by-step solution → - Question 21Physics· Motion in Plane
A bullet is fired from a gun at the speed of in the direction above the horizontal. The maximum height attained by the bullet is :
- Option A:
2000 m
- Option B:
1000 m
- Option C:
3000 m
- Option D:
2800 m
Answer: BStep-by-step solution → - Question 22Physics· Electrostatics
The net magnetic flux through any closed surface is :
- Option A:
Positive
- Option B:
Infinity
- Option C:
Negative
- Option D:
Zero
Answer: DStep-by-step solution → - Question 23Physics· Capacitors and R-C Circuits
The equivalent capacitance of the system shown in the following circuit is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 24Physics· Motion in one Dimension
A vehicle travels half the distance with speed and the remaining distance with speed . Its average speed is:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 25Physics· Nuclear Physics
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to of its initial value?
- Option A:
40 minutes
- Option B:
60 minutes
- Option C:
80 minutes
- Option D:
20 minutes
Answer: CStep-by-step solution → - Question 26Physics· Kinetic Theory of Gases
The temperature of a gas is . To what temperature should the gas be heated so that the rms speed becomes 4 times its initial value?
- Option A:
- Option B:
3097 K
- Option C:
223 K
- Option D:
Answer: AStep-by-step solution → - Question 27Physics· Electromagnetic Induction
The magnetic energy stored in an inductor of inductance carrying a current of 2 A is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 28Physics· Mechanical Properties of Matter
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight attached at its free end. The longitudinal stress at any point of cross-sectional area of the wire is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 29Physics· Electrostatics
An electric dipole is placed at an angle of with an electric field of intensity . It experiences a torque equal to 4 N m . Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm .
- Option A:
6 mC
- Option B:
4 mC
- Option C:
2 m C
- Option D:
8 mC
Answer: CStep-by-step solution → - Question 30Physics· Atomic Physics
In hydrogen spectrum, the shortest wavelength in the Balmer series is . The shortest wavelength in the Brackett series is
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 31Physics· Sound Waves
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 32Physics· Gravitation
Two bodies of mass and are placed at a distance . The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( = gravitational constant):
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 33Physics· Work, Power & Energy
A bullet from a gun is fired on a rectangular wooden block with velocity . When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
- Option A:
24 cm
- Option B:
28 cm
- Option C:
30 cm
- Option D:
27 cm
Answer: DStep-by-step solution → - Question 34Physics· Atomic Physics
The radius of inner most orbit of hydrogen atom is . What is the radius of third allowed orbit of hydrogen atom?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 35Physics· Friction
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is .
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 36Physics· Current Electricity
10 resistors, each of resistance are connected in series to a battery of emf and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased times. The value of is :
- Option A:
100
- Option B:
1
- Option C:
1000
- Option D:
10
Answer: AStep-by-step solution → - Question 37Physics· Motion in one Dimension
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity . The ball strikes the water surface after 4 s . The height of bridge above water surface is (Take ):
- Option A:
60 m
- Option B:
64 m
- Option C:
68 m
- Option D:
56 m
Answer: BStep-by-step solution → - Question 38Physics· Alternating Current
The net impedance of circuit (as shown in figure) will be :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 39Physics· Gravitation
A satellite is orbiting just above the surface of the earth with period . If is the density of the earth and is the universal constant of gravitation, the quantity represents :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 40Physics· Geometrical Optics
Two thin lenses are of same focal lengths , but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
- Option A:
- Option B:
- Option C:
Infinite
- Option D:
zero
Answer: CStep-by-step solution → - Question 41Physics· Semiconductor and Electronic Devices
For the following logic circuit, the truth table is:
- Option A:

- Option B:

- Option C:

- Option D:

Answer: AStep-by-step solution → - Question 42Physics· Moving Charges and Magnetic Field
A very long conducting wire is bent in a semi-circular shape from to as shown in figure. The magnetic field at point for steady current configuration is given by :
- Option A:
pointed away from the page
- Option B:
pointed away from page
- Option C:
pointed into the page
- Option D:
pointed into the page
Answer: BStep-by-step solution → - Question 43Physics· Current Electricity
The resistance of platinum wire at is and at . The temperature coefficient of resistance of the wire is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 44Physics· Electrostatics
An electric dipole is placed as shown in the figure. The electric potential (in ) at point P due to the dipole is permittivity of free space and ):
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 45Physics· Geometrical Optics
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
- Option A:
-40 cm
- Option B:
-100 cm
- Option C:
-50 cm
- Option D:
40 cm
Answer: BStep-by-step solution → - Question 46Physics· Moving Charges and Magnetic Field
A wire carrying a current along the positive -axis has length . It is kept in a magnetic field . The magnitude of the magnetic force acting on the wire is:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 47Physics· Simple Harmonic Motion
The graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 48Chemistry· d and f Block Elements
The stability of is more than salts in aqueous solution due to -
- Option A:
enthalpy of atomization
- Option B:
hydration energy
- Option C:
second ionisation enthalpy
- Option D:
first ionisation enthalpy
Answer: BStep-by-step solution → - Question 49Chemistry· Surface Chemistry
Which one is an example of heterogenous catalysis?
- Option A:
Hydrolysis of sugar catalysed by ions
- Option B:
Decomposition of ozone in presence of nitrogen monoxide.
- Option C:
Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
- Option D:
Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
Answer: CStep-by-step solution → - Question 50Chemistry· States of Matter - Gaseous State
Which amongst the following options is correct graphical representation of Boyle's Law?
- Option A:

- Option B:

- Option C:

- Option D:

Answer: AStep-by-step solution → - Question 51Chemistry· Chemical Kinetics
Given below are two statements, one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A): A reaction can have zero activation energy.
Reason (R): The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both (A) and (R) are true and (R) is the correct explanation of (A).
- Option B:
Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
- Option C:
(A) is true but (R) is false.
- Option D:
(A) is false but (R) is true.
Answer: BStep-by-step solution → - Question 52Chemistry· Practical Organic Chemistry
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with due to the formation of -
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 53Chemistry· Chemical Kinetics
For a certain reaction, the rate , when the initial concentration of is tripled keeping concentration of B constant, the initial rate would
- Option A:
increase by a factor of six
- Option B:
increases by a factor of nine
- Option C:
increases by a factor of three
- Option D:
decrease by a factor of nine
Answer: BStep-by-step solution → - Question 54Chemistry· p-Block (I) (Grp. 13, 14)
Match List - I with List - II Choose the correct answer from the options given below :
List - I List - II A. Coke I. Carbon atoms are hybridised. B. Diamond II. Used as a dry lubricant C. Fullerene III. Used as a reducing agent D. Graphite IV. Cage like molecules - Option A:
A-IV, B-I, C-II,D-III
- Option B:
A-III, B-I, C-IV,D-II
- Option C:
A-III, B-IV, C-I,D-II
- Option D:
A-II, B-IV, C-I,D-III
Answer: BStep-by-step solution → - Question 55Chemistry· Solid State
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy of tetrahedral voids. If the formula of the compound is , then the value of is in option
- Option A:
4
- Option B:
3
- Option C:
2
- Option D:
5
Answer: DStep-by-step solution → - Question 56Chemistry· Coordination Compounds
Homoleptic complex from the following complexes is :
- Option A:
Diamminechloridonitrito - N platinum (II)
- Option B:
Pentaamminecarbonatocobalt (III) chloride
- Option C:
Triamminetriaquachromium (III) chloride
- Option D:
Potassium trioxalatoaluminate (III)
Answer: DStep-by-step solution → - Question 57Chemistry· Chemical Bonding
The correct order of energies of molecular orbitals of molecule, is:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 58Chemistry· Solutions and Colligative Properties
Given below are two statements, one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A): Helium is used to dilute oxygen in diving apparatus.
Reason (R): Helium has high solubility in .
In light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both (A) and (R) are true and (R) is the correct explanation of (A).
- Option B:
Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
- Option C:
(A) is true but (R) is false.
- Option D:
(A) is false but (R) is true.
Answer: CStep-by-step solution → - Question 59Chemistry· Structure of Atom
Select the correct statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is .
C. All the isotopes of a given element show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
C, D and E only
- Option B:
A and R only
- Option C:
B, C and E only
- Option D:
A, B and C only
Answer: CStep-by-step solution → - Question 60Chemistry· IUPAC Nomenclature
The given compound is an example of ___ .
- Option A:
aryl halide
- Option B:
allylic halide
- Option C:
vinylic halide
- Option D:
benzylic halide
Answer: BStep-by-step solution → - Question 61Chemistry· Aldehydes and Ketones
Identify product (A) in the following reaction:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 62Chemistry· Electrochemistry
The conductivity of centimolar solution of KCl at is and the resistance of the cell containing the solution at is 60 ohm . The value of cell constant is -
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 63Chemistry· General Organic Chemistry
Amongst the given options, which of the following molecules/ions acts as a Lewis acid?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 64Chemistry· Structure of Atom
The relation between the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number , is
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 65Chemistry· States of Matter - Gaseous State
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole - dipole forces.
B. dipole - induced dipole forces.
C. hydrogen bonding.
D. covalent bonding.
E. dispersion forces.
Choose the most appropriate answer from the options given below :
- Option A:
A, B, C, D are correct
- Option B:
A, B, C, E are correct
- Option C:
A, C, D, E are correct
- Option D:
B, C, D, E are correct.
Answer: BStep-by-step solution → - Question 66Chemistry· Periodicity of Elements and Periodic Properties
The element expected to form largest ion to achieve the nearest noble gas configuration is :
- Option A:
F
- Option B:
N
- Option C:
Na
- Option D:
O
Answer: BStep-by-step solution → - Question 67Chemistry· chemistry in Everyday Life
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
- Option A:
Meprobamate
- Option B:
Valium
- Option C:
Veronal
- Option D:
Chlordiazepoxide
Answer: CStep-by-step solution → - Question 68Chemistry· Polymers
Which amongst the following molecules on polymerization produces neoprene?
Options: A) H₂C=C(Cl)CH=CH₂ B) H₂C=CH-C≡CH C) H₂C=CH-CH=CH₂ D) H₂C=C(CH₃)CH=CH₂
- Option A:

- Option B:

- Option C:

- Option D:

- Option E:
- Option F:
- Option G:
- Option H:
Answer: AStep-by-step solution → - Question 69Chemistry· Some Basic Concepts of Chemistry (Mole Concept) + Stoichiometry
The right option for the mass of produced by heating 20 g of pure limestone is
(Atomic mass of )
- Option A:
1.76 g
- Option B:
2.64 g
- Option C:
1.32 g
- Option D:
1.12 g
Answer: AStep-by-step solution → - Question 70Chemistry· IUPAC Nomenclature
The number of bonds, bonds and lone pairs of electrons in pyridine, respectively, are:
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 71Chemistry· Thermodynamics & Thermochemistry
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: AStep-by-step solution → - Question 72Chemistry· d and f Block Elements
Which of the following statements are INCORRECT?
A. All the transition metals except scandium form oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in to .
C. Basic character increases from to to .
D. dissolves in acids to give salts.
E. is basic but is amphoteric.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
B and D only
- Option B:
C and D only
- Option C:
B and C only
- Option D:
A and E only
Answer: BStep-by-step solution → - Question 73Chemistry· Solid State
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 74Chemistry· Thermodynamics & Thermochemistry
The equilibrium concentrations of the species in the reaction are 2, 3, 10 and 6 , respectively at 300 K. for the reaction is ( ).
- Option A:
-137.26 cal
- Option B:
-1381.50 cal
- Option C:
-13.73 cal
- Option D:
1372.60 cal
Answer: BStep-by-step solution → - Question 75Chemistry· Coordination Compounds
Which complex compound is most stable?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: BStep-by-step solution → - Question 76Chemistry· Redox Reactions
On balancing the given redox reaction, , the coefficients and are found to be, respectively -
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 77Chemistry· Environmental Chemistry
Given below are two statements, one is labelled as Statement I and the other is labelled as Statement II.
Statement I: The nutrient deficient water bodies lead to eutrophication.
Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statement I and statement ll are correct.
Answer: CStep-by-step solution → - Question 78Chemistry· p-Block Elements (Group 15-18)
Match List - I with List- II : List - I
List - I (Oxoacids of Sulphur) List - II (Bonds) A. Peroxodisulphuric acid I. Two ,Four , One S-O-S B. Sulphuric acid II. Two S-OH, One C. Pyrosulphuric acid III. Two S-OH,Four S=O, One S-O-O-S D. Sulphurous acid IV. Two S-OH, Two Choose the correct answer from the options given below :
- Option A:
A-III, B-IV, C-I, D-II
- Option B:
A-I, B-III, C-IV, D-II
- Option C:
A-III, B-IV, C-II, D-I
- Option D:
A-I, B-III, C-II, D-IV
Answer: AStep-by-step solution → - Question 79Botany· Plant Growth and Development
Which hormone promotes internode/petiole elongation in deep water rice?
- Option A:
Kinetin
- Option B:
Ethylene
- Option C:
2,4-D
- Option D:
Answer: BStep-by-step solution → - Question 80Botany· Sexual Reproduction in Flowering Plants
Large, colourful, fragrant flowers with nectar are seen in :
- Option A:
bird pollinated plants
- Option B:
bat pollinated plants
- Option C:
wind pollinated plants
- Option D:
insect pollinated plants
Answer: DStep-by-step solution → - Question 81Botany· Biodiversity and Conservation
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
- Option A:
1992
- Option B:
1986
- Option C:
2002
- Option D:
1985
Answer: AStep-by-step solution → - Question 82Botany· Molecular basis of Inheritance
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
- Option A:
DNA
- Option B:
Histones
- Option C:
polysaccharides
- Option D:
RNA
Answer: AStep-by-step solution → - Question 83Botany· Photosynthesis in Higher Plants
How many ATP and are required for the synthesis of one molecule of Glucose during Calvin cycle?
- Option A:
18 ATP and
- Option B:
12 ATP and
- Option C:
18 ATP and
- Option D:
12 ATP and
Answer: AStep-by-step solution → - Question 84Botany· Ecosystem
In the equation
GPP is Gross Primary Productivity
NPP is Net Primary Productivity R here is ____ .
- Option A:
Respiratory quotient
- Option B:
Respiratory loss
- Option C:
Reproductive allocation
- Option D:
Photosynthetically active radiation
Answer: BStep-by-step solution → - Question 85Botany· Molecular basis of Inheritance
In gene gun method used to introduce alien DNA into host cells, microparticles of_____ metal are used.
- Option A:
Zinc
- Option B:
Tungsten or gold
- Option C:
silver
- Option D:
Copper
Answer: BStep-by-step solution → - Question 86Botany· Principles of Inheritance and Variation
The phenomenon of pleiotropism refers to
- Option A:
presence of two alleles, each of the two genes controlling a single trait.
- Option B:
a single gene affecting multiple phenotypic expression
- Option C:
more than two genes affecting a single character
- Option D:
presence of several alleles of a single gene controlling a single crossover.
Answer: BStep-by-step solution → - Question 87Botany· Cell Cycle and Cell Division
Among eukaryotes, replication of DNA takes place in -
- Option A:
S phase
- Option B:
phase
- Option C:
phase
- Option D:
phase
Answer: AStep-by-step solution → - Question 88Botany· Morphology of Flowering Plants
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
- Option A:
Polyadelphous and epipetalous stamens
- Option B:
Monoadelphous and Monothecous anthers
- Option C:
Epiphyllous and Dithecous anthers
- Option D:
Diadelphous and Dithecous anthers
Answer: DStep-by-step solution → - Question 89Botany· Morphology of Flowering Plants
Axile placentation is observed in
- Option A:
China Rose, Beans and Lupin
- Option B:
Tomato, Dianthus and Pea
- Option C:
China rose, Petunia and Lemon
- Option D:
mustard, cucumber and prrimrose
Answer: CStep-by-step solution → - Question 90Botany· Plant Kingdom
Identify the pair of heterosporous pteridophytes among the following :
- Option A:
Selaginella and Salvinia
- Option B:
Psilotum and Salvinia
- Option C:
Equisetum and Salvinia
- Option D:
Lycopodium and Selaginella
Answer: AStep-by-step solution → - Question 91Botany· Sexual Reproduction in Flowering Plants
What is the function of tassels in the corn cob?
- Option A:
To trap pollen grains
- Option B:
To disperse pollen grain
- Option C:
To protect seeds
- Option D:
To attract insects
Answer: AStep-by-step solution → - Question 92Botany· Plant Kingdom
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason (R): Protonema develops directly from spores produced in capsule.
In light of the above statements, choose the most appropriate answer from the options given below.
- Option A:
Both and are correct but is NOT the correct explanation of .
- Option B:
is correct but is not correct
- Option C:
is not correct but is correct.
- Option D:
Both and are correct and is the correct explanation of .
Answer: DStep-by-step solution → - Question 93Botany· Plant Growth and Development
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
- Option A:
Gibberellic Acid
- Option B:
Zeatin
- Option C:
Abscisic ACid
- Option D:
Indole-3-butyric Acid
Answer: AStep-by-step solution → - Question 94Botany· Principles of Inheritance and Variation
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
- Option A:
Sutton and Boveri
- Option B:
Alfred STurtevant
- Option C:
Henking
- Option D:
Thomas Hunt Morgan
Answer: BStep-by-step solution → - Question 95Botany· Molecular basis of Inheritance
Expressed Sequence Tags (ESTs) refers to
- Option A:
All genes that are expressed as proteins
- Option B:
All genes whether expressed or unexpressed.
- Option C:
Certain important expressed genes.
- Option D:
All genes that are expressed as RNA.
Answer: DStep-by-step solution → - Question 96Botany· Molecular basis of Inheritance
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
- Option A:
Bright blue in colour
- Option B:
Bright yellow colour
- Option C:
Bright orange colour
- Option D:
Bright red colour
Answer: CStep-by-step solution → - Question 97Botany· Respiration in Plants
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): ATP is used at two steps in glycolysis.
Reason (R): First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6phosphate into fructose-1-6-diphosphate.
In light of the above statements, choose the most appropriate answer from the options given below.
- Option A:
Both (A) and (R) are true and (R) is the correct explanation of (A).
- Option B:
Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
- Option C:
(A) is true but (R) is false.
- Option D:
(A) is false but (R) is true.
Answer: AStep-by-step solution → - Question 98Botany· Molecular basis of Inheritance
Unequivocal proof that DNA is the genetic material was first proposed by
- Option A:
Alfred Hershey and Martha Chase
- Option B:
Avery, MacLeod and McCarty
- Option C:
Wilkins and Franklin
- Option D:
Frederick Griffith
Answer: AStep-by-step solution → - Question 99Botany· Ecosystem
Identify the correct statements: A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
B, C and D only
- Option B:
C, D and E only
- Option C:
D, E and A only
- Option D:
A, B and C only
Answer: DStep-by-step solution → - Question 100Botany· Photosynthesis in Higher Plants
The reaction centre in PS II has an absorption maxima at
- Option A:
700 nm
- Option B:
660 nm
- Option C:
780 nm
- Option D:
680 nm
Answer: DStep-by-step solution → - Question 101Botany· Plant Kingdom
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
- Option A:
Antipodals, synergids, and primary endosperm nucleus
- Option B:
Synergids, Zygote and Primary endosperm nucleus
- Option C:
Synergids, antipodals and Polar nuclei
- Option D:
Synergids, Primary endosperm nucleus and zygote
Answer: BStep-by-step solution → - Question 102Botany· Cell Cycle and Cell Division
Which of the following stages of meiosis involves division of centromere?
- Option A:
Metaphase II
- Option B:
Anaphase II
- Option C:
Telophase
- Option D:
Metaphase I
Answer: BStep-by-step solution → - Question 103Botany· Biodiversity and Conservation
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
- Option A:
Over exploitation for economic gain
- Option B:
Alien species invasions
- Option C:
Co-extinctions
- Option D:
Habitat loss and fragmentation
Answer: DStep-by-step solution → - Question 104Botany· Molecular basis of Inheritance
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
- Option A:
Transcription of tRNA, 5 srRNA and snRNA
- Option B:
Transcription of precursor of mRNA
- Option C:
Transcription of only snRNAs
- Option D:
Transcription of rRNAs (28S, 18S and
Answer: AStep-by-step solution → - Question 105Botany· Anatomy of Flowering Plants
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II: Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: CStep-by-step solution → - Question 106Botany· Cell Cycle and Cell Division
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
- Option A:
pachytene
- Option B:
Diplotene
- Option C:
Diakinesis
- Option D:
Zygotene
Answer: AStep-by-step solution → - Question 107Botany· Plant Kingdom
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason (R): Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In light of the above statements, choose the most appropriate answer from the options given below.er from the options given below :
- Option A:
Both (A) and (R) are true and (R) is the correct explanation of (A).
- Option B:
Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
- Option C:
(A) is true but (R) is false.
- Option D:
(A) is false but (R) is true.
Answer: CStep-by-step solution → - Question 108Botany· Plant Kingdom
Which one of the following statements is NOT correct?
- Option A:
Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
- Option B:
Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
- Option C:
The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
- Option D:
The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms
Answer: AStep-by-step solution → - Question 109Botany· Photosynthesis in Higher Plants
Which of the following combinations is required for chemiosmosis?
- Option A:
membrane, proton pump, proton gradient, NADP synthase
- Option B:
proton pump, electron gradient, ATP synthase
- Option C:
proton pump, electron gradient, NADP synthase
- Option D:
membrane, proton pump, proton gradient, ATP synthase
Answer: DStep-by-step solution → - Question 110Botany· Cell Cycle and Cell Division
Match List I with List II :
List I List II A. M Phase I. Proteins are synthesized B. Phase II. Inactive phase C. Quiescent stage III. Interval between mitosis and initiation of DNA replication D. Phase IV. Equational division Choose the correct answer from the options given below :
- Option A:
A-IV, B-II, C-I, D-III
- Option B:
A-IV, B-I, C-II, D-III
- Option C:
A-II, B-IV, C-I, D-III
- Option D:
A-III, B-II, C-IV, D-I
Answer: BStep-by-step solution → - Question 111Botany· Organisms and Populations
Match List I with List II :
List I List II A. Mutualism I. +(A), O(B) B. Commensalism II. -(A), O(B) C. Amensalism III. +(A), -(B) D. Parasitism IV. +(A), +(B) Choose the correct answer from the options given below :
- Option A:
A-IV, B-I, C-II, D-III
- Option B:
A-IV, B-III, C-I, D-II
- Option C:
A-III, B-I, C-IV, D-II
- Option D:
A-IV, B-II, C-I, D-III
Answer: AStep-by-step solution → - Question 112Botany· Organisms and Populations
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II: In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: BStep-by-step solution → - Question 113Botany· Principles of Inheritance and Variation
Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile.
Choose the correct answer from the options given below :
- Option A:
C and D only
- Option B:
B and E only
- Option C:
A and E only
- Option D:
A and B only
Answer: BStep-by-step solution → - Question 114Botany· Molecular basis of Inheritance
How many different proteins does the ribosome consist of?
- Option A:
60
- Option B:
40
- Option C:
20
- Option D:
80
Answer: DStep-by-step solution → - Question 115Botany· Respiration in Plants
Match List I with List II :
List I List II A. Oxidative decarboxylation I. Citrate synthase B. Glycolysis II. Pyruvate dehydrogenase C. Oxidative phosphorylation III. Electron transport system D. Tricarboxylic acid cycle IV. EMP pathway Choose the correct answer from the options given below :
- Option A:
A-II, B-IV, C-I, D-III
- Option B:
A-III, B-I, C-II, D-IV
- Option C:
A-II, B-IV, C-III, D-I
- Option D:
A-III, B-IV, C-II, D-I
Answer: CStep-by-step solution → - Question 116Botany· Morphology of Flowering Plants
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A): A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason (R): Internodes of the shoot get condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In light of the above statements, choose the most appropriate answer from the options given below.
- Option A:
Both and are true but is NOT the correct explanation of .
- Option B:
is true but is false
- Option C:
is false but is true.
- Option D:
Both and are true and R is the correct explanation of .
Answer: DStep-by-step solution → - Question 117Botany· Molecular basis of Inheritance
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below :
- Option A:
- Option B:
C,B,A,D
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 118Zoology· Human Reproduction
Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
- Option A:
A and B only
- Option B:
A, B and C only
- Option C:
A, C and D only
- Option D:
A and D only
Answer: CStep-by-step solution → - Question 119Zoology· Breathing and Exchange of Gases
Vital capacity of lung is___
- Option A:
IRV + ERV + TV + RV
- Option B:
IRV + ERV + TV - RV
- Option C:
IRV + ERV + TV
- Option D:
IRV + ERV
Answer: CStep-by-step solution → - Question 120Zoology· Reproductive Health
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
- Option A:
Gonorrhoea
- Option B:
Hepatitis-B
- Option C:
HIV Infection
- Option D:
Genital herpes
Answer: AStep-by-step solution → - Question 121Zoology· Chemical Control and Coordination
Match List I with List II.
List I List II A. CCK I. Kidney B. GIP II. Heart C. ANF III. Gastric gland D. ADH IV. Pancreas Choose the correct answer from the options given below:
- Option A:
A-III, B-II, C-IV, D-I
- Option B:
A-II, B-IV, C-I, D-III
- Option C:
A-IV, B-II, C-III, D-I
- Option D:
A-IV, B-III, C-II, D-I
Answer: DStep-by-step solution → - Question 122Zoology· Human Health and Diseases
Match List I with List II. List I List II
List I List II A. Ringworm I. Haemophilus influenzae B. Filariasis II. Trichophyton C. Malaria III. Wuchereria bancrofti D. Pneumonia IV. Plasmodium vivax Choose the correct answer from the options given below:
- Option A:
A-II, B-III, C-I, D-IV
- Option B:
A-III, B-II, C-I, D-IV
- Option C:
A-III, B-II, C-IV, D-I
- Option D:
A-II, B-III, C-IV, D-I
Answer: DStep-by-step solution → - Question 123Zoology· Body Fluids and Circulation
Match List I with List II.
List I List II A. P - wave I. Beginning of systole B. Q - wave II. Repolarisation of ventricles C. QRS complex III. Depolarisation of atria D. T - wave IV. Depolarisation of ventricles Choose the correct answer from the options given below:
- Option A:
A-IV, B-III, C-II, D-I
- Option B:
A-II, B-IV, C-I, D-III
- Option C:
A-I, B-II, C-III, D-IV
- Option D:
A-III, B-I, C-IV, D-II
Answer: DStep-by-step solution → - Question 124Zoology· Human Health and Diseases
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
- Option A:
B-lymphocytes
- Option B:
Basophils
- Option C:
Eosinophils
- Option D:
cells
Answer: DStep-by-step solution → - Question 125Zoology· Biomolecules
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: DStep-by-step solution → - Question 126Zoology· Biomolecules
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid ( N -terminal)
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of type and two subunits of type.)
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statements I and II are incorrect.
- Option B:
Statement I is correct and Statement II is incorrect.
- Option C:
Statement I is incorrect and Statement II is correct.
- Option D:
Both statements I and II are correct.
Answer: CStep-by-step solution → - Question 127Zoology· Excretory Products and their Elimination
Match List I with List II.
List I List II A. Taenia I. Nephridia B. Paramoecium II. Contractile vacuole C. Periplaneta III. Flame cells D. Pheretima IV. Urecose gland Choose the correct answer from the options give below:
- Option A:
A-I, B-II, C-IV, D-III
- Option B:
A-III, B-II, C-IV, D-I
- Option C:
A-II, B-I, C-IV, D-III
- Option D:
A-I, B-II, C-III, D-IV
Answer: BStep-by-step solution → - Question 128Zoology· Human Reproduction
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are incorrect.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: DStep-by-step solution → - Question 129Zoology· Animal Kingdom
Radial symmetry is NOT found in adults of phylum___
- Option A:
Hemichordata
- Option B:
Coelenterata
- Option C:
Echinodermata
- Option D:
Ctenophora
Answer: AStep-by-step solution → - Question 130Botany· Cell: The Unit of Life
Which of the following functions is carried out by cytoskeleton in a cell?
- Option A:
Protein synthesis
- Option B:
Motility
- Option C:
Transportation
- Option D:
Nuclear division
Answer: BStep-by-step solution → - Question 131Zoology· Reproductive Health
Match List I with List II. List I
List I List II A. Vasectomy I. Oral method B. Coitus interruptus II. Barrier method C. Cervical caps III. Surgical method D. Saheli IV. Natural method Choose the correct answer from the options given below:
- Option A:
A-III, B-IV, C-II, D-I
- Option B:
A-II, B-III, C-I, D-IV
- Option C:
A-IV, B-II, C-I, D-III
- Option D:
A-III, B-I, C-IV, D-II
Answer: AStep-by-step solution → - Question 132Zoology· Locomotion and Movement
Match List I with List II.
List I (Type of Joint) List II (Found between) A. Cartilaginous Joint I. Between flat skull bones B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column C. Fibrous Joint III. Between carpal and metacarpal of thumb D. Saddle Joint IV. Between Humerus and Pectoral girdle Choose the correct answer from the options given below:
- Option A:
A-II, B-IV, C-I, D-III
- Option B:
A-I, B-IV, C-III, D-II
- Option C:
A-II, B-IV, C-III, D-I
- Option D:
A-I, B-III, C-IV, D-II
Answer: AStep-by-step solution → - Question 133Zoology· Human Health and Diseases
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are correct.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are correct.
Answer: DStep-by-step solution → - Question 134Botany· Molecular basis of Inheritance
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both Statement I and Statement II are false.
- Option B:
Statement I is true but Statement II is false.
- Option C:
Statement I is false but Statement II is true
- Option D:
Both Statement I and Statement II are true.
Answer: CStep-by-step solution → - Question 135Zoology· Evolution
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
- Option A:
Numbat, Spotted cuscus, Flying phalanger
- Option B:
Mole, Flying squirrel, Tasmanian tiger cat
- Option C:
Lemur, Anteater, Wolf
- Option D:
Tasmanian wolf, Bobcat, Marsupial mole
Answer: AStep-by-step solution → - Question 136Zoology· Biotechnology: Principles and Processes
Which of the following is not a cloning vector?
- Option A:
YAC
- Option B:
pBR322
- Option C:
probe
- Option D:
BAC
Answer: CStep-by-step solution → - Question 137Zoology· Human Health and Diseases
Match List I with List II.
List I List II A. Heroin I. Effect on cardiovascular system B. Marijuana II. Slow down body function C. Cocaine III. Painkille D. Morphine IV. Interfere with transport of dopamine Choose the correct answer from the options given below:
- Option A:
A-I, B-II, C-III, D-IV
- Option B:
A-IV, B-III, C-II, D-I
- Option C:
A-III, B-IV, C-I, D-II
- Option D:
A-II, B-I, C-IV, D-III
Answer: DStep-by-step solution → - Question 138Zoology· Biotechnology and its Applications
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
- Option A:
Serum and urine analysis
- Option B:
Polymerase Chain Reaction (PCR) technique
- Option C:
Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
- Option D:
Recombinant DNA Technology
Answer: AStep-by-step solution → - Question 139Zoology· Human Reproduction
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In light of the above statements, choose the most appropriate answer from the options given below.
- Option A:
Both and are true but is NOT the correct explanation of .
- Option B:
is true but is false.
- Option C:
is false but is true.
- Option D:
Both and are true and is the correct explanation of .
Answer: AStep-by-step solution → - Question 140Botany· Molecular basis of Inheritance
Match List I with List II.
List I List II A. Gene ‘ ’ I. -galactosidase B. Gene ' ' II. Transacetylase C. Gene ' ' III. Permease D. Gene ' ' IV. Repressor protein Choose the correct answer from the options given below:
- Option A:
A-II, B-III, C-IV, D-I
- Option B:
A-III, B-IV, C-I, D-II
- Option C:
A-III, B-I, C-IV, D-II
- Option D:
A-II, B-I, C-IV, D-III
Answer: AStep-by-step solution → - Question 141Zoology· Excretory Products and their Elimination
Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason (R): Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In light of the above statements, choose the most appropriate answer from the options given below.
- Option A:
Both and are true but is NOT the correct explanation of .
- Option B:
is true but is false.
- Option C:
is false but is true.
- Option D:
Both and are true and is the correct explanation of .
Answer: BStep-by-step solution → - Question 142Botany· Cell Cycle and Cell Division
Select the correct statements.
A. Tetrad formprsenceation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
- Option A:
B and D only
- Option B:
A, C and E only
- Option C:
B and E only
- Option D:
A and C only
Answer: AStep-by-step solution → - Question 143Zoology· Excretory Products and their Elimination
Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
B,C and D only
- Option B:
A, B and E only
- Option C:
C,D and E only
- Option D:
A and B only
Answer: AStep-by-step solution → - Question 144Botany· Cell Cycle and Cell Division
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: During phase of cell cycle, the cell is metabolically inactive.
Statement II: The centrosome undergoes duplication during phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both statement I and statement Il are correct.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are incorrect.
Answer: CStep-by-step solution → - Question 145Botany· Ecosystem
Match List I with List II.
List I List II A. Logistic growth I. Unlimited resource availability condition B. Exponential growth II. Limited resource availability condition I C. Expanding age pyramid III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups D. Stable age pyramid IV. The percent individuals of pre-reproductives and reproductive age group are same Choose the correct answer from the options given below:
- Option A:
A-II, B-III, C-I, D-IV
- Option B:
A-II, B-IV, C-I, D-III
- Option C:
A-II, B-IV, C-III, D-I
- Option D:
A-II, B-I, C-III, D-IV
Answer: DStep-by-step solution → - Question 146Zoology· Chemical Control and Coordination
Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
- Option A:
B and C only
- Option B:
C and D only
- Option C:
D and E only
- Option D:
A and D only
Answer: BStep-by-step solution → - Question 147Zoology· Animal Kingdom
The unique mammalian characteristics are:
- Option A:
pinna and mammary glands
- Option B:
hairs, pinna and indirect developement
- Option C:
pinna, monocondylic skull and mammary glands
- Option D:
hairs, tympanic membrane and mammary glands
Answer: AStep-by-step solution → - Question 148Zoology· Locomotion and Movement
Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
B and C only
- Option B:
A, C and D only
- Option C:
C and D only
- Option D:
A, B and C only
Answer: AStep-by-step solution → - Question 149Zoology· Body Fluids and Circulation
Which of the following statements are correct ?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
C and E only
- Option B:
B and C only
- Option C:
A and B only
- Option D:
D and E only
Answer: BStep-by-step solution → - Question 150Zoology· Neural Control and Coordination
The parts of the human brain that help in the regulation of sexual behaviour, expression of excitement, pleasure, rage, fear, etc. are:
- Option A:
corpora quadrigemina and hippocampus
- Option B:
Brain stem & epithalamus
- Option C:
Corpus callosum and thalamus
- Option D:
Limbic system & hypothalamus
Answer: DStep-by-step solution → - Question 151Zoology· Animal Kingdom
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
B and C only
- Option B:
B, D and E only
- Option C:
C, D and E only
- Option D:
A, C and D only
Answer: AStep-by-step solution → - Question 152Physics· Semiconductor and Electronic Devices
In half wave rectification, if the input frequency is 60 Hz , then the output frequency would be
- Option A:
120 Hz
- Option B:
Zero
- Option C:
30 Hz
- Option D:
60 Hz
Answer: DStep-by-step solution → - Question 153Botany· Transport in plant
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
- Option A:
Facilitated Diffusion
- Option B:
Passive Transport
- Option C:
Active Transport
- Option D:
Osmosis
Answer: CStep-by-step solution → - Question 154Botany· Anatomy of Flowering Plants
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
- Option A:
Both A and R are true but R is NOT the correct explanation of A
- Option B:
A is true but R is false
- Option C:
A is false but R is true
- Option D:
Both A and R are true and R is the correct explanation of A
Answer: DStep-by-step solution → - Question 155Botany· Transport in plant
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
- Option A:
Both Statement I and Statement II are incorrect
- Option B:
Statement I is correct but Statement II is incorrect
- Option C:
Statement I is incorrect but Statement II is correct
- Option D:
Both Statement I and Statement II are correct
Answer: DStep-by-step solution → - Question 156Botany· Mineral Nutrition
Which micronutrient is required for splitting of water molecule during photosynthesis?
- Option A:
Molybdenum
- Option B:
Magnesium
- Option C:
Copper
- Option D:
Manganese
Answer: DStep-by-step solution → - Question 157Botany· Mineral Nutrition
Match List I with List II: Choose the correct answer from the options given below:
List I List II I. Iron Synthesis of auxin II. Zinc Component of nitrate reductase III. Boron Activator of catalase IV. Molybdenum Cell elongation and differentiation - Option A:
A-II, B-III, C-IV, D-I
- Option B:
A-III, B-I, C-IV, D-II
- Option C:
A-II, B-IV, C-I, D-III
- Option D:
A-III, B-II, C-I, D-IV
Answer: CStep-by-step solution → - Question 158Botany· Anatomy of Flowering Plants
Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
In the light of the above statements, choose the correct answer from the options given below :
- Option A:
A and D only
- Option B:
A, B and D only
- Option C:
B and C only
- Option D:
B, C and E only
Answer: AStep-by-step solution → - Question 159Botany· Microbes in Human Welfare
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
- Option A:
Amylase
- Option B:
Lipase
- Option C:
Dinitrogenase
- Option D:
Succinic dehydrogenase
Answer: DStep-by-step solution → - Question 160Botany· Organisms and Populations
Match List I with List II.Choose the correct answer from the options given below.
List I (Interacting species) List II (Name of interaction) A. A Leopard and a Lion in a forest/grassland I. Competition B. A Cuckoo laying egg in a Crow’s nest II. Brood parasitism C. Fungi and root of a higher plant in Mycorrhizae III. Mutualism D. A cattle egret and a Cattle in a field IV. Commensalism - Option A:
A-I, B-II, C-IV, D-III
- Option B:
A-III, B-IV, C-I, D-II
- Option C:
A-II, B-III, C-I, D-IV
- Option D:
A-I, B-II, C-III, D-IV
Answer: DStep-by-step solution → - Question 161Zoology· Structural Organisation in Animals
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
- Option A:
Presence of anal styles
- Option B:
Presence of sclerites
- Option C:
Presence of anal cerci
- Option D:
Dark brown body colour and anal cerci
Answer: AStep-by-step solution → - Question 162Zoology· Biomolecules
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
- Option A:
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
- Option B:
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
- Option C:
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
- Option D:
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
Answer: BStep-by-step solution → - Question 163Zoology· Structural Organisation in Animals
Match List I with List II.Choose the correct answer from the options give below:
List I List II A. Mast cells I. Ciliated epithelium B. Inner surface of bronchiole II. Areolar connective tissue C. Blood III. Cuboidal epithelium D. Tubular parts of nephron IV. Specialised connective tissue - Option A:
A-II, B-III, C-I, D-IV
- Option B:
A-II, B-I, C-IV, D-III
- Option C:
A-III, B-IV, C-II, D-I
- Option D:
A-I, B-II, C-IV, D-III
Answer: BStep-by-step solution → - Question 164Zoology· Structural Organisation in Animals
In cockroach, excretion is brought about by: A. Phallic gland B. Uricose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:
- Option A:
A, B and E only
- Option B:
B, C and D only
- Option C:
B and D only
- Option D:
A and E only
Answer: BStep-by-step solution → - Question 165Botany· Biotechnology
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
- Option A:
Dedifferentiation
- Option B:
Development
- Option C:
Senescence
- Option D:
Differentiation
Answer: AStep-by-step solution → - Question 166Chemistry· Environmental Chemistry
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
- Option A:
Decibels
- Option B:
Decameter
- Option C:
Kilobase
- Option D:
Dobson units
Answer: DStep-by-step solution → - Question 167Zoology· Biomolecules
Cellulose does not form blue colour with Iodine because
- Option A:
It is a helical molecule
- Option B:
It does not contain complex helices and hence cannot hold iodine molecules
- Option C:
It breakes down when iodine reacts with it
- Option D:
It is a disaccharide
Answer: BStep-by-step solution → - Question 168Botany· Transport in plant
Match List I with List II :
List I List II A. Cohesion I. More attraction in liquid phase B. Adhesion II. Mutual attraction among water molecules C. Surface tension III. Water loss in liquid phase D. Guttation IV. Attraction towards polar surfaces - Option A:
A – IV, B – III, C – II, D – I
- Option B:
A – III, B – I, C – IV, D – II
- Option C:
A – II, B – I, C – IV, D – III
- Option D:
A – II, B – IV, C – I, D – III
Answer: DStep-by-step solution → - Question 169Zoology· Structural Organisation in Animals
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
- Option A:
Both statement I and statement Il are correct.
- Option B:
Statement I is correct and statement Il is incorrect.
- Option C:
Statement I is incorrect and statement Il is correct.
- Option D:
Both statements 1 and statements ll are incorrect.
Answer: DStep-by-step solution → - Question 170Botany· Principles of Inheritance and Variation
Broad palm with single palm crease is visible in a person suffering from-
- Option A:
Turner’s syndrome
- Option B:
Klinefelter’s syndrome
- Option C:
Thalassemia
- Option D:
Down’s syndrome
Answer: DStep-by-step solution → - Question 171Botany· NEET 2024 Deleted Syllabus
Which of the following statements is correct?
- Option A:
Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
- Option B:
Presence of large amount of nutrients in water restricts ‘Algal Bloom’
- Option C:
Algal Bloom decreases fish mortality
- Option D:
Eutrophication refers to increase in domestic sewage and waste water in lakes.
Answer: AStep-by-step solution → - Question 172Botany· NEET 2024 Deleted Syllabus
Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :
Statement I: Electrostatic precipitator is most widely used in thermal power plant .
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations .
In the light of the above statements, choose the most appropriate answer from the options given below:
- Option A:
Both Statement I and Statement II are incorrect.
- Option B:
Statement I is correct but Statement II is incorrect.
- Option C:
Statement I is incorrect but Statement II is correct.
- Option D:
Both Statement I and Statement II are correct.
Answer: BStep-by-step solution → - Question 173Zoology· Digestion and absorption
Match List I with List II
List I (Cells) List II (Secretion) A. Peptic cells I. Mucus B. Goblet cells II. Bile juice C. Oxyntic cells III. Proenzyme pepsinogen D. Hepatic cells IV. HCl and intrinsic factor for absorption of vitamin - Option A:
A-II, B-I, C-III, D-IV
- Option B:
A-III, B-I, C-IV, D-II
- Option C:
A-II, B-IV, C-I, D-III
- Option D:
A-IV, B-III, C-II, D-I
Answer: BStep-by-step solution → - Question 174Zoology· NEET 2024 Deleted Syllabus
Match List I with List II with respect to human eye.
List I List II A. Fovea I. Visible coloured portion of eye that regulates diameter of pupil. B. Iris II. External layer of eye formed of dense connective tissue. C. Blind spot III. Point of greatest visual acuity or resolution. D. Sclera IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent - Option A:
A-IV, B-III, C-II, D-I
- Option B:
A-I, B-IV, C-III, D-II
- Option C:
A-II, B-I, C-III, D-IV
- Option D:
A-III, B-I, C-IV, D-II
Answer: DStep-by-step solution → - Question 175Zoology· Digestion and absorption
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
- Option A:
Ileo-caecal valve
- Option B:
Gastro-oesophageal sphincter
- Option C:
Pyloric sphincter
- Option D:
Sphincter of Oddi
Answer: AStep-by-step solution → - Question 176Physics· Semiconductor and Electronic Devices
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
- Option A:
p-n junction diodes
- Option B:
Capacitor
- Option C:
Load resistance
- Option D:
A centre-tapped transformer
Answer: BStep-by-step solution → - Question 177Physics· Thermodynamics
A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is
- Option A:
15°C
- Option B:
100°C
- Option C:
200°C
- Option D:
27°C
Answer: DStep-by-step solution → - Question 178Chemistry· Alkaline Earth Metals - Group 2
Taking stability as the factor, which one of the following represents correct relationship?
- Option A:
- Option B:
- Option C:
- Option D:
Answer: CStep-by-step solution → - Question 179Chemistry· Hydrogen and its Compounds
Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils.
D. The H–H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below:
- Option A:
B, D only
- Option B:
D, E only
- Option C:
A, B, C only
- Option D:
B, C, D, E only
Answer: BStep-by-step solution → - Question 180Chemistry· Biomolecules
Given below are two statements : one is labelled as Statement 1 and the other is labelled as Statement 2 :
Statement I : A unit formed by the attachment of a base to 1′ position of sugar is known as nucleoside.
Statement II : When nucleoside is linked to phosphorous acid at 5′ -position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below :
- Option A:
Both Statement I and Statement II are false
- Option B:
Statement I is true but Statement II is false
- Option C:
Statement I is false but Statement II is true
- Option D:
Both Statement I and Statement II are true
Answer: BStep-by-step solution → - Question 181Chemistry· Alkali Metals - Group 1
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason : The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below :
- Option A:
Both A and R are true but R is NOT the correct explanation of A
- Option B:
A is true but R is false
- Option C:
A is false but R is true
- Option D:
Both A and R are true and R is the correct explanation of A
Answer: BStep-by-step solution → - Question 182Chemistry· Thermodynamics & Thermochemistry
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
- Option A:
- Option B:
- Option C:
- Option D:
Answer: DStep-by-step solution → - Question 183Chemistry· Surface Chemistry
Pumice stone is an example of
- Option A:
Gel
- Option B:
Solid sol
- Option C:
Foam
- Option D:
Sol
Answer: BStep-by-step solution → - Question 184Botany· Plant Growth and Development
Which hormone promotes internode/petiole elongation in deep water rice?
- Option A:
Kinetin
- Option B:
Ethylene
- Option C:
2, 4-D
- Option D:
Answer: BStep-by-step solution → - Question 185Botany· Cell: The Unit of Life
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
- Option A:
A, C and E only
- Option B:
A and D only
- Option C:
A, D and E only
- Option D:
B and D only
Answer: AStep-by-step solution →
Stuck on one of these?
Practise questions like them — free, with a tutor that explains every step.