NEET (UG) 2023 · previous year paper

NEET (UG) 2023

185 questions with the verified answer key. Open any question for its step-by-step solution.

  1. Question 1Physics· Rotational Dynamics

    The ratio of radius of gyration of a solid sphere of mass MM and radius RR about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :

    1. Option A:

      3:53:5

    2. Option B:

      5:25:2

    3. Option C:

      5:2\sqrt{5}:\sqrt{ 2}

    4. Option D:

      3:5\sqrt{3}:\sqrt{ 5}

  2. Question 2Physics· Atomic Physics

    The work functions of Caesium (Cs), Potassium ( K ) and Sodium ( Na ) are 2.14 eV , 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV , which of these photosensitive surfaces may emit photoelectrons?

    1. Option A:

      Both Na and K

    2. Option B:

      K only

    3. Option C:

      Na only

    4. Option D:

      Cs only

  3. Question 3Physics· Mechanical Properties of Matter

    The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution =0.03 N m−1)\left.=0.03 \mathrm{~N} \mathrm{~m}^{-1}\right)

    1. Option A:

      5.06×10−4 J5.06 \times 10^{-4} \mathrm{~J}

    2. Option B:

      3.01×10−4 J3.01 \times 10^{-4} \mathrm{~J}

    3. Option C:

      50.1×10−4 J50.1 \times 10^{-4} \mathrm{~J}

    4. Option D:

      30.16×10−4 J30.16 \times 10^{-4} \mathrm{~J}

  4. Question 4Physics· Units, Dimensions & Error Analysis

    Resistance of a carbon resistor determined from colour codes is (22000±5%)Ω(22000 \pm 5 \%) \Omega. The colour of third band must be :

    1. Option A:

      Green

    2. Option B:

      Orange

    3. Option C:

      Yellow

    4. Option D:

      Red

  5. Question 5Physics· Alternating Current

    In a series LCRL C R circuit, the inductance LL is 10 mH , capacitance CC is 1μ F1 \mu \mathrm{~F} and resistance RR is 100Ω100 \Omega. The frequency at which resonance occurs is :

    1. Option A:

      15.9 kHz

    2. Option B:

      1.59rad/s1.59 \mathrm{rad} / \mathrm{s}

    3. Option C:

      1.59 kHz

    4. Option D:

      15.9

  6. Question 6Physics· Electromagnetic Waves

    In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0×1010 Hz2.0 \times 10^{10} \mathrm{~Hz} and amplitude 48Vm−148 \mathrm{Vm}^{-1}. Then the amplitude of oscillating magnetic field is : (Speed of light in free space =3×108 m s−1=3 \times 10^{8} \mathrm{~m} \mathrm{~s}^{-1} )

    1. Option A:

      1.6×10−8 T1.6 \times 10^{-8} \mathrm{~T}

    2. Option B:

      1.6×10−7 T1.6 \times 10^{-7} \mathrm{~T}

    3. Option C:

      1.6×10−6 T1.6 \times 10^{-6} \mathrm{~T}

    4. Option D:

      1.6×10−9 T1.6 \times 10^{-9} \mathrm{~T}

  7. Question 7Physics· Semiconductor and Electronic Devices

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Photovoltaic devices can convert optical radiation into electricity.

    Statement II: Zener diode is designed to operate under reverse bias in breakdown region.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  8. Question 8Physics· Units, Dimensions & Error Analysis

    The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

    1. Option A:

      Personal errors

    2. Option B:

      Least count errors

    3. Option C:

      Random errors

    4. Option D:

      Instrumental errors

  9. Question 9Physics· Electrostatics

    If ∮SE⃗⋅dS⃗=0\oint_S \vec{E} \cdot d\vec{S} = 0 over a surface, then :

    1. Option A:

      the magnitude of electric field on the surface is constant.

    2. Option B:

      all the charges must necessarily be inside the surface.

    3. Option C:

      the electric field inside the surface is necessarily uniform.

    4. Option D:

      the number of flux lines entering the surface must be equal to the number of flux lines leaving it.

  10. Question 10Physics· Current Electricity

    If the galvanometer GG does not show any deflection in the circuit shown, the value of RR is given by :

    Question 10 figure
    1. Option A:

      50Ω50 \Omega

    2. Option B:

      100Ω100 \Omega

    3. Option C:

      400Ω400 \Omega

    4. Option D:

      200Ω200 \Omega

  11. Question 11Physics· Electromagnetic Waves

    An ac source is connected to a capacitor CC. Due to decrease in its operating frequency :

    1. Option A:

      displacement current increases

    2. Option B:

      displacement current decreases

    3. Option C:

      capacitive reactanceremains constant

    4. Option D:

      Capacitive reactance decreases

  12. Question 12Physics· Atomic Physics

    The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:

    1. Option A:

      1V\frac{1}{V}

    2. Option B:

      1V\frac{1}{\sqrt{V}}

    3. Option C:

      V2V^{2}

    4. Option D:

      V\sqrt{V}

  13. Question 13Physics· Fluid Mechanics

    The venturi-meter works on :

    1. Option A:

      Bernoulli's principle

    2. Option B:

      The principle of parallel axes

    3. Option C:

      The principle of perpendicular axes

    4. Option D:

      Huygen's principle

  14. Question 14Physics· Units, Dimensions & Error Analysis

    A metal wire has mass (0.4±0.002)g(0.4 \pm 0.002) \mathrm{g}, radius (0.3±0.001)mm(0.3 \pm 0.001) \mathrm{mm} and length (5±0.02)cm(5 \pm 0.02) \mathrm{cm}. The maximum possible percentage error in the measurement of density will nearly be:

    1. Option A:

      1.3%1.3 \%

    2. Option B:

      1.6%1.6 \%

    3. Option C:

      1.4%1.4 \%

    4. Option D:

      1.2%1.2 \%

  15. Question 15Physics· Wave Optics

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant.

    Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  16. Question 16Physics· Work, Power & Energy

    The potential energy of a long spring when stretched by 2 cm is UU. If the spring is stretched by 8 cm , potential energy stored in it will be :

    1. Option A:

      4 U

    2. Option B:

      8 U

    3. Option C:

      16 U

    4. Option D:

      2 U

  17. Question 17Physics· Geometrical Optics

    Light travels a distance xx in time t1t_{1} in air and 10x10 x in time t2t_{2} in another denser medium. What is the critical angle for this medium?

    1. Option A:

      sin⁡−1(10t2t1)\sin ^{-1}\left(\frac{10 t_{2}}{t_{1}}\right)

    2. Option B:

      sin⁡−1(t110t2)\sin ^{-1}\left(\frac{t_{1}}{10 t_{2}}\right)

    3. Option C:

      sin⁡−1(10t1t2)\sin ^{-1}\left(\frac{10 t_{1}}{t_{2}}\right)

    4. Option D:

      sin⁡−1(t2t1)\sin ^{-1}\left(\frac{t_{2}}{t_{1}}\right)

  18. Question 18Physics· Electromagnetic Induction

    A 12 V,60 W12 \mathrm{~V}, 60 \mathrm{~W} lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V . Assuming the transformer to be ideal, what is the current in the primary winding?

    1. Option A:

      2.7 A

    2. Option B:

      3.7 A

    3. Option C:

      0.37 A

    4. Option D:

      0.27 A

  19. Question 19Physics· Motion in Plane

    A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

    1. Option A:

      along northward

    2. Option B:

      along north-east

    3. Option C:

      along south-west

    4. Option D:

      along eastward

  20. Question 20Physics· Rotational Dynamics

    The angular acceleration of a body, moving along the circumference of a circle, is :

    1. Option A:

      along the radius towards the centre

    2. Option B:

      along the tangent to its position

    3. Option C:

      along the axis of rotation

    4. Option D:

      along the radius, away from centre

  21. Question 21Physics· Motion in Plane

    A bullet is fired from a gun at the speed of 280 m s−1280 \mathrm{~m} \mathrm{~s}^{-1} in the direction 30∘30^{\circ} above the horizontal. The maximum height attained by the bullet is (g=9.8 m s−2,sin⁡30∘=0.5)\left(\mathrm{g}=9.8 \mathrm{~m} \mathrm{~s}^{-2}, \sin 30^{\circ}=0.5\right) :

    1. Option A:

      2000 m

    2. Option B:

      1000 m

    3. Option C:

      3000 m

    4. Option D:

      2800 m

  22. Question 22Physics· Electrostatics

    The net magnetic flux through any closed surface is :

    1. Option A:

      Positive

    2. Option B:

      Infinity

    3. Option C:

      Negative

    4. Option D:

      Zero

  23. Question 23Physics· Capacitors and R-C Circuits

    The equivalent capacitance of the system shown in the following circuit is :

    Question 23 figure
    1. Option A:

      3μ F3 \mu \mathrm{~F}

    2. Option B:

      6μ F6 \mu \mathrm{~F}

    3. Option C:

      9μ F9 \mu \mathrm{~F}

    4. Option D:

      2μ F2 \mu \mathrm{~F}

  24. Question 24Physics· Motion in one Dimension

    A vehicle travels half the distance with speed ϑ\vartheta and the remaining distance with speed 2ϑ2 \vartheta. Its average speed is:

    1. Option A:

      2ϑ3\frac{2 \vartheta}{3}

    2. Option B:

      4ϑ3\frac{4 \vartheta}{3}

    3. Option C:

      3ϑ4\frac{3 \vartheta}{4}

    4. Option D:

      ϑ3\frac{\vartheta}{3}

  25. Question 25Physics· Nuclear Physics

    The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (116)th \left(\frac{1}{16}\right)^{\text {th }} of its initial value?

    1. Option A:

      40 minutes

    2. Option B:

      60 minutes

    3. Option C:

      80 minutes

    4. Option D:

      20 minutes

  26. Question 26Physics· Kinetic Theory of Gases

    The temperature of a gas is −50∘C-50^\circ\mathrm{C}. To what temperature should the gas be heated so that the rms speed becomes 4 times its initial value?

    1. Option A:

      3295∘C3295^{\circ} \mathrm{C}

    2. Option B:

      3097 K

    3. Option C:

      223 K

    4. Option D:

      669∘C669^{\circ} \mathrm{C}

  27. Question 27Physics· Electromagnetic Induction

    The magnetic energy stored in an inductor of inductance 4μH4 \mu \mathrm{H} carrying a current of 2 A is :

    1. Option A:

      44 mJmJ

    2. Option B:

      88 mJmJ

    3. Option C:

      8μ J8 \mu \mathrm{~J}

    4. Option D:

      4μ J4 \mu \mathrm{~J}

  28. Question 28Physics· Mechanical Properties of Matter

    Let a wire be suspended from the ceiling (rigid support) and stretched by a weight WW attached at its free end. The longitudinal stress at any point of cross-sectional area AA of the wire is :

    1. Option A:

      W/AW / A

    2. Option B:

      W/2AW / 2 A

    3. Option C:

      zerozero

    4. Option D:

      2W/A2 W / A

  29. Question 29Physics· Electrostatics

    An electric dipole is placed at an angle of 30∘30^{\circ} with an electric field of intensity 2×105 NC−12 \times 10^{5} \mathrm{~N} \mathrm{C}^{-1}. It experiences a torque equal to 4 N m . Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm .

    1. Option A:

      6 mC

    2. Option B:

      4 mC

    3. Option C:

      2 m C

    4. Option D:

      8 mC

  30. Question 30Physics· Atomic Physics

    In hydrogen spectrum, the shortest wavelength in the Balmer series is λ\lambda. The shortest wavelength in the Brackett series is

    1. Option A:

      4λ4 \lambda

    2. Option B:

      9λ9 \lambda

    3. Option C:

      16λ16 \lambda

    4. Option D:

      2λ2 \lambda

  31. Question 31Physics· Sound Waves

    The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :

    1. Option A:

      2:12: 1

    2. Option B:

      1:31: 3

    3. Option C:

      3:13: 1

    4. Option D:

      1:21: 2

  32. Question 32Physics· Gravitation

    Two bodies of mass mm and 9m9m are placed at a distance RR. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( GG = gravitational constant):

    1. Option A:

      −12GmR-\frac{12 G m}{R}

    2. Option B:

      −16GmR-\frac{16 G m}{R}

    3. Option C:

      −20GmR-\frac{20 G m}{R}

    4. Option D:

      −8GmR-\frac{8 G m}{R}

  33. Question 33Physics· Work, Power & Energy

    A bullet from a gun is fired on a rectangular wooden block with velocity uu. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u3\frac{u}{3}. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :

    1. Option A:

      24 cm

    2. Option B:

      28 cm

    3. Option C:

      30 cm

    4. Option D:

      27 cm

  34. Question 34Physics· Atomic Physics

    The radius of inner most orbit of hydrogen atom is 5.3×10−11 m5.3 \times 10^{-11} \mathrm{~m}. What is the radius of third allowed orbit of hydrogen atom?

    1. Option A:

      1.06  A01.06\;\mathop A\limits^0

    2. Option B:

      1.59  A01.59\;\mathop A\limits^0

    3. Option C:

      4.77  A0 4.77\;\mathop A\limits^0

    4. Option D:

      0.53  A0 0.53\;\mathop A\limits^0

  35. Question 35Physics· Friction

    Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15( g=10 m s−2)0.15\left(\mathrm{~g}=10 \mathrm{~m} \mathrm{~s}^{-2}\right).

    1. Option A:

      150 m s−2150 \mathrm{~m} \mathrm{~s}^{-2}

    2. Option B:

      1.5 m s−21.5 \mathrm{~m} \mathrm{~s}^{-2}

    3. Option C:

      50 m s−250 \mathrm{~m} \mathrm{~s}^{-2}

    4. Option D:

      1.2 m s−21.2 \mathrm{~m} \mathrm{~s}^{-2}

  36. Question 36Physics· Current Electricity

    10 resistors, each of resistance RR are connected in series to a battery of emf EE and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased nn times. The value of nn is :

    1. Option A:

      100

    2. Option B:

      1

    3. Option C:

      1000

    4. Option D:

      10

  37. Question 37Physics· Motion in one Dimension

    A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s−14 \mathrm{~m} \mathrm{~s}^{-1}. The ball strikes the water surface after 4 s . The height of bridge above water surface is (Take g=10 m s−2\mathrm{g}=10 \mathrm{~m} \mathrm{~s}^{-2} ):

    1. Option A:

      60 m

    2. Option B:

      64 m

    3. Option C:

      68 m

    4. Option D:

      56 m

  38. Question 38Physics· Alternating Current

    The net impedance of circuit (as shown in figure) will be :

    Question 38 figure
    1. Option A:

      15Ω15 \Omega

    2. Option B:

      55Ω5 \sqrt{5} \Omega

    3. Option C:

      25Ω25 \Omega

    4. Option D:

      102Ω10 \sqrt{2} \Omega

  39. Question 39Physics· Gravitation

    A satellite is orbiting just above the surface of the earth with period TT. If dd is the density of the earth and GG is the universal constant of gravitation, the quantity 3πGd\frac{3 \pi}{G d} represents :

    1. Option A:

      T2T^{2}

    2. Option B:

      T3T^{3}

    3. Option C:

      T\sqrt{T}

    4. Option D:

      TT

  40. Question 40Physics· Geometrical Optics

    Two thin lenses are of same focal lengths (f)(f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :

    1. Option A:

      f/4f / 4

    2. Option B:

      f/2f / 2

    3. Option C:

      Infinite

    4. Option D:

      zero

  41. Question 41Physics· Semiconductor and Electronic Devices

    For the following logic circuit, the truth table is:

    Question 41 figure
    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  42. Question 42Physics· Moving Charges and Magnetic Field

    A very long conducting wire is bent in a semi-circular shape from AA to BB as shown in figure. The magnetic field at point PP for steady current configuration is given by :

    Question 42 figure
    1. Option A:

      μ0i4R\frac{\mu_{0} i}{4 R} pointed away from the page

    2. Option B:

      μ0i4R[1−2π]\frac{\mu_{0} i}{4 R}\left[1-\frac{2}{\pi}\right] pointed away from page

    3. Option C:

      μ0i4R[1−2π]\frac{\mu_{0} i}{4 R}\left[1-\frac{2}{\pi}\right] pointed into the page

    4. Option D:

      μ0i4R\frac{\mu_{0} i}{4 R} pointed into the page

  43. Question 43Physics· Current Electricity

    The resistance of platinum wire at 0∘C0^{\circ} \mathrm{C} is 2Ω2 \Omega and 6.8Ω6.8 \Omega at 80∘C80^{\circ} \mathrm{C}. The temperature coefficient of resistance of the wire is :

    1. Option A:

      3×10−3∘C−13 \times 10^{-3}{ }^{\circ} \mathrm{C}^{-1}

    2. Option B:

      3×10−2∘C−13 \times 10^{-2}{ }^{\circ} \mathrm{C}^{-1}

    3. Option C:

      3×10−1∘C−13 \times 10^{-1}{ }^{\circ} \mathrm{C}^{-1}

    4. Option D:

      3×10−4∘C−13 \times 10^{-4}{ }^{\circ} \mathrm{C}^{-1}

  44. Question 44Physics· Electrostatics

    An electric dipole is placed as shown in the figure. The electric potential (in 102 V10^{2} \mathrm{~V} ) at point P due to the dipole is (ϵ0=\left(\epsilon_{0}=\right. permittivity of free space and 14πϵ0=K\frac{1}{4 \pi \epsilon_{0}}=K ):

    Question 44 figure
    1. Option A:

      (58)qK\left(\frac{5}{8}\right) q K

    2. Option B:

      (85)qK\left(\frac{8}{5}\right) \mathrm{qK}

    3. Option C:

      (83)qK\left(\frac{8}{3}\right) q K

    4. Option D:

      (38)qK\left(\frac{3}{8}\right) \mathrm{qK}

  45. Question 45Physics· Geometrical Optics

    In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?

    Question 45 figure
    1. Option A:

      -40 cm

    2. Option B:

      -100 cm

    3. Option C:

      -50 cm

    4. Option D:

      40 cm

  46. Question 46Physics· Moving Charges and Magnetic Field

    A wire carrying a current II along the positive xx-axis has length LL. It is kept in a magnetic field B⃗=(2i^+3j^−4k^) T\vec{B} = (2\hat{i} + 3\hat{j} - 4\hat{k})\, \text{T}. The magnitude of the magnetic force acting on the wire is:

    1. Option A:

      5IL\sqrt{5} \mathrm{IL}

    2. Option B:

      55 ILIL

    3. Option C:

      3IL\sqrt{3} \mathrm{IL}

    4. Option D:

      33 ILIL

  47. Question 47Physics· Simple Harmonic Motion

    The x−tx-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at t=2 st=2 \mathrm{~s} is :

    Question 47 figure
    1. Option A:

      −π28 m s−2-\frac{\pi^{2}}{8} \mathrm{~m} \mathrm{~s}^{-2}

    2. Option B:

      π216 m s−2\frac{\pi^{2}}{16} \mathrm{~m} \mathrm{~s}^{-2}

    3. Option C:

      −π216 m s−2-\frac{\pi^{2}}{16} \mathrm{~m} \mathrm{~s}^{-2}

    4. Option D:

      π28 m s−2\frac{\pi^{2}}{8} \mathrm{~m} \mathrm{~s}^{-2}

  48. Question 48Chemistry· d and f Block Elements

    The stability of Cu2+\mathrm{Cu}^{2+} is more than Cu+\mathrm{Cu}^{+}salts in aqueous solution due to -

    1. Option A:

      enthalpy of atomization

    2. Option B:

      hydration energy

    3. Option C:

      second ionisation enthalpy

    4. Option D:

      first ionisation enthalpy

  49. Question 49Chemistry· Surface Chemistry

    Which one is an example of heterogenous catalysis?

    1. Option A:

      Hydrolysis of sugar catalysed by H+\mathrm{H}^{+} ions

    2. Option B:

      Decomposition of ozone in presence of nitrogen monoxide.

    3. Option C:

      Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.

    4. Option D:

      Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.

  50. Question 50Chemistry· States of Matter - Gaseous State

    Which amongst the following options is correct graphical representation of Boyle's Law?

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  51. Question 51Chemistry· Chemical Kinetics

    Given below are two statements, one is labelled as Assertion (A) and the other is labelled as Reason (R).

    Assertion (A): A reaction can have zero activation energy.

    Reason (R): The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.

    In light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both (A) and (R) are true and (R) is the correct explanation of (A).

    2. Option B:

      Both (A) and (R) are true and (R) is NOT the correct explanation of (A).

    3. Option C:

      (A) is true but (R) is false.

    4. Option D:

      (A) is false but (R) is true.

  52. Question 52Chemistry· Practical Organic Chemistry

    In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe3+\mathrm{Fe}^{3+} due to the formation of -

    1. Option A:

      NaSCNNaSCN

    2. Option B:

      [Fe(CN)5NOS]4−\left[\mathrm{Fe}(\mathrm{CN})_{5} \mathrm{NOS}\right]^{4-}

    3. Option C:

      [Fe(SCN)]2+[\mathrm{Fe}(\mathrm{SCN})]^{2+}

    4. Option D:

      Fe4[Fe(CN)6]3⋅xH2O\mathrm{Fe}_{4}\left[\mathrm{Fe}(\mathrm{CN})_{6}\right]_{3} \cdot \mathrm{xH}_{2} \mathrm{O}

  53. Question 53Chemistry· Chemical Kinetics

    For a certain reaction, the rate =k[A]2[B]=k[A]^{2}[B], when the initial concentration of AA is tripled keeping concentration of B constant, the initial rate would

    1. Option A:

      increase by a factor of six

    2. Option B:

      increases by a factor of nine

    3. Option C:

      increases by a factor of three

    4. Option D:

      decrease by a factor of nine

  54. Question 54Chemistry· p-Block (I) (Grp. 13, 14)

    Match List - I with List - II Choose the correct answer from the options given below :

    List - IList - II
    A. CokeI. Carbon atoms are sp3\mathrm{sp}^{3} hybridised.
    B. DiamondII. Used as a dry lubricant
    C. FullereneIII. Used as a reducing agent
    D. GraphiteIV. Cage like molecules
    1. Option A:

      A-IV, B-I, C-II,D-III

    2. Option B:

      A-III, B-I, C-IV,D-II

    3. Option C:

      A-III, B-IV, C-I,D-II

    4. Option D:

      A-II, B-IV, C-I,D-III

  55. Question 55Chemistry· Solid State

    A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/31 / 3 of tetrahedral voids. If the formula of the compound is AxByA_{x} B_{y}, then the value of x+y\mathrm{x}+\mathrm{y} is in option

    1. Option A:

      4

    2. Option B:

      3

    3. Option C:

      2

    4. Option D:

      5

  56. Question 56Chemistry· Coordination Compounds

    Homoleptic complex from the following complexes is :

    1. Option A:

      Diamminechloridonitrito - N platinum (II)

    2. Option B:

      Pentaamminecarbonatocobalt (III) chloride

    3. Option C:

      Triamminetriaquachromium (III) chloride

    4. Option D:

      Potassium trioxalatoaluminate (III)

  57. Question 57Chemistry· Chemical Bonding

    The correct order of energies of molecular orbitals of N2N_2 molecule, is:

    1. Option A:

      σ1s<σ1s∗<σ2s<σ2s∗<σ2pz<(π2px=π2py)<(π2px∗=π2py∗)<σ2pz∗\sigma_{1s} < \sigma^*_{1s} < \sigma_{2s} < \sigma^*_{2s} < \sigma_{2p_z} < (\pi_{2p_x} = \pi_{2p_y}) < (\pi^*_{2p_x} = \pi^*_{2p_y}) < \sigma^*_{2p_z}

    2. Option B:

      σ1s<σ1s∗<σ2s<σ2s∗<σ2pz<σ2pz∗<(π2px=π2py)<(π2px∗=π2py∗)\sigma_{1s} < \sigma^*_{1s} < \sigma_{2s} < \sigma^*_{2s} < \sigma_{2p_z} < \sigma^*_{2p_z} < (\pi_{2p_x} = \pi_{2p_y}) < (\pi^*_{2p_x} = \pi^*_{2p_y})

    3. Option C:

      σ1s<σ1s∗<σ2s<σ2s∗<(π2px=π2py)<(π2px∗=π2py∗)<σ2pz<σ2pz∗\sigma_{1s} < \sigma^*_{1s} < \sigma_{2s} < \sigma^*_{2s} < (\pi_{2p_x} = \pi_{2p_y}) < (\pi^*_{2p_x} = \pi^*_{2p_y}) < \sigma_{2p_z} < \sigma^*_{2p_z}

    4. Option D:

      σ1s<σ1s∗<σ2s<σ2s∗<(π2px=π2py)<σ2pz<(π2px∗=π2py∗)<σ2pz∗\sigma_{1s} < \sigma^*_{1s} < \sigma_{2s} < \sigma^*_{2s} < (\pi_{2p_x} = \pi_{2p_y}) < \sigma_{2p_z} < (\pi^*_{2p_x} = \pi^*_{2p_y}) < \sigma^*_{2p_z}

  58. Question 58Chemistry· Solutions and Colligative Properties

    Given below are two statements, one is labelled as Assertion (A) and the other is labelled as Reason (R).

    Assertion (A): Helium is used to dilute oxygen in diving apparatus.

    Reason (R): Helium has high solubility in O2\mathrm{O}_{2}.

    In light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both (A) and (R) are true and (R) is the correct explanation of (A).

    2. Option B:

      Both (A) and (R) are true and (R) is NOT the correct explanation of (A).

    3. Option C:

      (A) is true but (R) is false.

    4. Option D:

      (A) is false but (R) is true.

  59. Question 59Chemistry· Structure of Atom

    Select the correct statements from the following :

    A. Atoms of all elements are composed of two fundamental particles.

    B. The mass of the electron is 9.10939×10−31 kg9.10939 \times 10^{-31} \mathrm{~kg}.

    C. All the isotopes of a given element show same chemical properties.

    D. Protons and electrons are collectively known as nucleons.

    E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      C, D and E only

    2. Option B:

      A and R only

    3. Option C:

      B, C and E only

    4. Option D:

      A, B and C only

  60. Question 60Chemistry· IUPAC Nomenclature

    The given compound is an example of ___ .

    Question 60 figure
    1. Option A:

      aryl halide

    2. Option B:

      allylic halide

    3. Option C:

      vinylic halide

    4. Option D:

      benzylic halide

  61. Question 61Chemistry· Aldehydes and Ketones

    Identify product (A) in the following reaction:

    structure

    Question 61 figure
    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
  62. Question 62Chemistry· Electrochemistry

    The conductivity of centimolar solution of KCl at 25∘C25^{\circ} \mathrm{C} is 0.0210ohm−1 cm−10.0210 \mathrm{ohm}^{-1} \mathrm{~cm}^{-1} and the resistance of the cell containing the solution at 25∘C25^{\circ} \mathrm{C} is 60 ohm . The value of cell constant is -

    1. Option A:

      3.28 cm−13.28 \mathrm{~cm}^{-1}

    2. Option B:

      1.26 cm−11.26 \mathrm{~cm}^{-1}

    3. Option C:

      3.34 cm−13.34 \mathrm{~cm}^{-1}

    4. Option D:

      1.34 cm−11.34 \mathrm{~cm}^{-1}

  63. Question 63Chemistry· General Organic Chemistry

    Amongst the given options, which of the following molecules/ions acts as a Lewis acid?

    1. Option A:

      H2O\mathrm{H}_{2} \mathrm{O}

    2. Option B:

      BF3\mathrm{BF}_{3}

    3. Option C:

      OHX−\ce{OH-}

    4. Option D:

      NH3\mathrm{NH}_{3}

  64. Question 64Chemistry· Structure of Atom

    The relation between nm,(nm=n_{m},\left(n_{m}=\right. the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l)(l), is

    1. Option A:

      l=2nm+1l=2 \mathrm{n}_{\mathrm{m}}+1

    2. Option B:

      nm=2l2+1\mathrm{n}_{\mathrm{m}}=2 l^{2}+1

    3. Option C:

      nm=l+2\mathrm{n}_{\mathrm{m}}=l+2

    4. Option D:

      l=nm−12l=\frac{\mathrm{n}_{\mathrm{m}}-1}{2}

  65. Question 65Chemistry· States of Matter - Gaseous State

    Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :

    A. dipole - dipole forces.

    B. dipole - induced dipole forces.

    C. hydrogen bonding.

    D. covalent bonding.

    E. dispersion forces.

    Choose the most appropriate answer from the options given below :

    1. Option A:

      A, B, C, D are correct

    2. Option B:

      A, B, C, E are correct

    3. Option C:

      A, C, D, E are correct

    4. Option D:

      B, C, D, E are correct.

  66. Question 66Chemistry· Periodicity of Elements and Periodic Properties

    The element expected to form largest ion to achieve the nearest noble gas configuration is :

    1. Option A:

      F

    2. Option B:

      N

    3. Option C:

      Na

    4. Option D:

      O

  67. Question 67Chemistry· chemistry in Everyday Life

    Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

    1. Option A:

      Meprobamate

    2. Option B:

      Valium

    3. Option C:

      Veronal

    4. Option D:

      Chlordiazepoxide

  68. Question 68Chemistry· Polymers

    Which amongst the following molecules on polymerization produces neoprene?

    Options: A) H₂C=C(Cl)CH=CH₂ B) H₂C=CH-C≡CH C) H₂C=CH-CH=CH₂ D) H₂C=C(CH₃)CH=CH₂

    1. Option A:
      Option A figure
    2. Option B:
      Option B figure
    3. Option C:
      Option C figure
    4. Option D:
      Option D figure
    5. Option E:

      HX2C=C(Cl)−CH=CHX2\ce{H2C=C(Cl)-CH=CH2}

    6. Option F:

      HX2C=CH−C≡CH\ce{H2C=CH-C#CH}

    7. Option G:

      HX2C=C(CHX3)−CH=CHX2\ce{H2C=C(CH3)-CH=CH2}

    8. Option H:

      HX2C=CH−CH=CHX2\ce{H2C=CH-CH=CH2}

  69. Question 69Chemistry· Some Basic Concepts of Chemistry (Mole Concept) + Stoichiometry

    The right option for the mass of CO2\mathrm{CO}_{2} produced by heating 20 g of 20%20 \% pure limestone is

    (Atomic mass of Ca=40\mathrm{Ca}=40 ) [CaCO3→1200 KCaO+CO2]\left[\mathrm{CaCO}_{3} \xrightarrow{1200 \mathrm{~K}} \mathrm{CaO}+\mathrm{CO}_{2}\right]

    1. Option A:

      1.76 g

    2. Option B:

      2.64 g

    3. Option C:

      1.32 g

    4. Option D:

      1.12 g

  70. Question 70Chemistry· IUPAC Nomenclature

    The number of σ\sigma bonds, π\pi bonds and lone pairs of electrons in pyridine, respectively, are:

    1. Option A:

      12,3,012,3,0

    2. Option B:

      11,3,111,3,1

    3. Option C:

      12,2,112,2,1

    4. Option D:

      11,2,011,2,0

  71. Question 71Chemistry· Thermodynamics & Thermochemistry

    Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

    1. Option A:

      ΔH=ΔU+ΔngRT\Delta \mathrm{H}=\Delta \mathrm{U}+\Delta \mathrm{n}_{\mathrm{g}} \mathrm{RT}

    2. Option B:

      ΔH−ΔU=−ΔnRT\Delta \mathrm{H}-\Delta \mathrm{U}=-\Delta \mathrm{nRT}

    3. Option C:

      ΔH+ΔU=ΔnR\Delta \mathrm{H}+\Delta \mathrm{U}=\Delta \mathrm{nR}

    4. Option D:

      ΔH=ΔU−ΔngRT\Delta \mathrm{H}=\Delta \mathrm{U}-\Delta \mathrm{n}_{\mathrm{g}} \mathrm{RT}

  72. Question 72Chemistry· d and f Block Elements

    Which of the following statements are INCORRECT?

    A. All the transition metals except scandium form MOMO oxides which are ionic.

    B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc2O3\mathrm{Sc}_{2} \mathrm{O}_{3} to Mn2O7\mathrm{Mn}_{2} \mathrm{O}_{7}.

    C. Basic character increases from V2O3\mathrm{V}_{2} \mathrm{O}_{3} to V2O4\mathrm{V}_{2} \mathrm{O}_{4} to V2O5\mathrm{V}_{2} \mathrm{O}_{5}.

    D. V2O4\mathrm{V}_{2} \mathrm{O}_{4} dissolves in acids to give VO43−\mathrm{VO}_{4}^{3-} salts.

    E. CrO\mathrm{CrO} is basic but Cr2O3\mathrm{Cr}_{2} \mathrm{O}_{3} is amphoteric.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      B and D only

    2. Option B:

      C and D only

    3. Option C:

      B and C only

    4. Option D:

      A and E only

  73. Question 73Chemistry· Solid State

    What fraction of one edge centred octahedral void lies in one unit cell of fcc?

    1. Option A:

      13\frac{1}{3}

    2. Option B:

      14\frac{1}{4}

    3. Option C:

      112\frac{1}{12}

    4. Option D:

      12\frac{1}{2}

  74. Question 74Chemistry· Thermodynamics & Thermochemistry

    The equilibrium concentrations of the species in the reaction A+B⇌C+DA + B \rightleftharpoons C + D are 2, 3, 10 and 6 mol L−1\mathrm{mol\,L^{-1}}, respectively at 300 K. ΔG∘\Delta G^\circ for the reaction is ( R=2 cal mol−1 K−1R = 2\ \mathrm{cal\,mol^{-1}\,K^{-1}}).

    1. Option A:

      -137.26 cal

    2. Option B:

      -1381.50 cal

    3. Option C:

      -13.73 cal

    4. Option D:

      1372.60 cal

  75. Question 75Chemistry· Coordination Compounds

    Which complex compound is most stable?

    1. Option A:

      [Co(NH3)3(NO3)3]\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{3}\left(\mathrm{NO}_{3}\right)_{3}\right]

    2. Option B:

      [CoCl2( en )2]NO3\left[\mathrm{CoCl}_{2}(\text { en })_{2}\right] \mathrm{NO}_{3}

    3. Option C:

      [Co(NH3)6]2(SO4)3\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{6}\right]_{2}\left(\mathrm{SO}_{4}\right)_{3}

    4. Option D:

      [Co(NH3)4(H2O)Br](NO3)2\left[\mathrm{Co}\left(\mathrm{NH}_{3}\right)_{4}\left(\mathrm{H}_{2} \mathrm{O}\right) \mathrm{Br}\right]\left(\mathrm{NO}_{3}\right)_{2}

  76. Question 76Chemistry· Redox Reactions

    On balancing the given redox reaction, aCrX2OX7X2−+bSOX3X2−(aq)+cHX+(aq)→2aCrX3+(aq)+bSOX4X2−(aq)+c2HX2O(l)a\ce{Cr2O7^{2-}} + b\ce{SO3^{2-}}(aq) + c\ce{H+}(aq) \rightarrow 2a\ce{Cr^{3+}}(aq) + b\ce{SO4^{2-}}(aq) + \frac{c}{2}\ce{H2O}(l), the coefficients a,ba, b and cc are found to be, respectively -

    1. Option A:

      3,8,13,8,1

    2. Option B:

      1,8,31,8,3

    3. Option C:

      8,1,38,1,3

    4. Option D:

      1,3,81,3,8

  77. Question 77Chemistry· Environmental Chemistry

    Given below are two statements, one is labelled as Statement I and the other is labelled as Statement II.

    Statement I: The nutrient deficient water bodies lead to eutrophication.

    Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statement I and statement ll are correct.

  78. Question 78Chemistry· p-Block Elements (Group 15-18)

    Match List - I with List- II : List - I

    List - I (Oxoacids of Sulphur)List - II (Bonds)
    A. Peroxodisulphuric acidI. Two S−OH\mathrm{S}-\mathrm{OH},Four S=O\mathrm{S}=\mathrm{O}, One S-O-S
    B. Sulphuric acidII. Two S-OH, One S=O\mathrm{S}=\mathrm{O}
    C. Pyrosulphuric acidIII. Two S-OH,Four S=O, One S-O-O-S
    D. Sulphurous acidIV. Two S-OH, Two S=O\mathrm{S}=\mathrm{O}

    Choose the correct answer from the options given below :

    1. Option A:

      A-III, B-IV, C-I, D-II

    2. Option B:

      A-I, B-III, C-IV, D-II

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-I, B-III, C-II, D-IV

  79. Question 79Botany· Plant Growth and Development

    Which hormone promotes internode/petiole elongation in deep water rice?

    1. Option A:

      Kinetin

    2. Option B:

      Ethylene

    3. Option C:

      2,4-D

    4. Option D:

      GA3\mathrm{GA}_{3}

  80. Question 80Botany· Sexual Reproduction in Flowering Plants

    Large, colourful, fragrant flowers with nectar are seen in :

    1. Option A:

      bird pollinated plants

    2. Option B:

      bat pollinated plants

    3. Option C:

      wind pollinated plants

    4. Option D:

      insect pollinated plants

  81. Question 81Botany· Biodiversity and Conservation

    The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :

    1. Option A:

      1992

    2. Option B:

      1986

    3. Option C:

      2002

    4. Option D:

      1985

  82. Question 82Botany· Molecular basis of Inheritance

    During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

    1. Option A:

      DNA

    2. Option B:

      Histones

    3. Option C:

      polysaccharides

    4. Option D:

      RNA

  83. Question 83Botany· Photosynthesis in Higher Plants

    How many ATP and NADPH2\mathrm{NADPH}_{2} are required for the synthesis of one molecule of Glucose during Calvin cycle?

    1. Option A:

      18 ATP and 12NADPH212 \mathrm{NADPH}_{2}

    2. Option B:

      12 ATP and 16NADPH216 \mathrm{NADPH}_{2}

    3. Option C:

      18 ATP and 16NADPH216 \mathrm{NADPH}_{2}

    4. Option D:

      12 ATP and 12NADPH212 \mathrm{NADPH}_{2}

  84. Question 84Botany· Ecosystem

    In the equation

    GPP−R=NPP\mathrm{GPP}-\mathrm{R}=\mathrm{NPP}

    GPP is Gross Primary Productivity

    NPP is Net Primary Productivity R here is ____ .

    1. Option A:

      Respiratory quotient

    2. Option B:

      Respiratory loss

    3. Option C:

      Reproductive allocation

    4. Option D:

      Photosynthetically active radiation

  85. Question 85Botany· Molecular basis of Inheritance

    In gene gun method used to introduce alien DNA into host cells, microparticles of_____ metal are used.

    1. Option A:

      Zinc

    2. Option B:

      Tungsten or gold

    3. Option C:

      silver

    4. Option D:

      Copper

  86. Question 86Botany· Principles of Inheritance and Variation

    The phenomenon of pleiotropism refers to

    1. Option A:

      presence of two alleles, each of the two genes controlling a single trait.

    2. Option B:

      a single gene affecting multiple phenotypic expression

    3. Option C:

      more than two genes affecting a single character

    4. Option D:

      presence of several alleles of a single gene controlling a single crossover.

  87. Question 87Botany· Cell Cycle and Cell Division

    Among eukaryotes, replication of DNA takes place in -

    1. Option A:

      S phase

    2. Option B:

      G1\mathrm{G}_{1} phase

    3. Option C:

      G2\mathrm{G}_{2} phase

    4. Option D:

      MM phase

  88. Question 88Botany· Morphology of Flowering Plants

    Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

    1. Option A:

      Polyadelphous and epipetalous stamens

    2. Option B:

      Monoadelphous and Monothecous anthers

    3. Option C:

      Epiphyllous and Dithecous anthers

    4. Option D:

      Diadelphous and Dithecous anthers

  89. Question 89Botany· Morphology of Flowering Plants

    Axile placentation is observed in

    1. Option A:

      China Rose, Beans and Lupin

    2. Option B:

      Tomato, Dianthus and Pea

    3. Option C:

      China rose, Petunia and Lemon

    4. Option D:

      mustard, cucumber and prrimrose

  90. Question 90Botany· Plant Kingdom

    Identify the pair of heterosporous pteridophytes among the following :

    1. Option A:

      Selaginella and Salvinia

    2. Option B:

      Psilotum and Salvinia

    3. Option C:

      Equisetum and Salvinia

    4. Option D:

      Lycopodium and Selaginella

  91. Question 91Botany· Sexual Reproduction in Flowering Plants

    What is the function of tassels in the corn cob?

    1. Option A:

      To trap pollen grains

    2. Option B:

      To disperse pollen grain

    3. Option C:

      To protect seeds

    4. Option D:

      To attract insects

  92. Question 92Botany· Plant Kingdom

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)

    Assertion (A): The first stage of gametophyte in the life cycle of moss is protonema stage.

    Reason (R): Protonema develops directly from spores produced in capsule.

    In light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both A\mathbf{A} and R\mathbf{R} are correct but R\mathbf{R} is NOT the correct explanation of A\mathbf{A}.

    2. Option B:

      A\mathbf{A} is correct but R\mathbf{R} is not correct

    3. Option C:

      A\mathbf{A} is not correct but R\mathbf{R} is correct.

    4. Option D:

      Both A\mathbf{A} and R\mathbf{R} are correct and R\mathbf{R} is the correct explanation of A\mathbf{A}.

  93. Question 93Botany· Plant Growth and Development

    Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

    1. Option A:

      Gibberellic Acid

    2. Option B:

      Zeatin

    3. Option C:

      Abscisic ACid

    4. Option D:

      Indole-3-butyric Acid

  94. Question 94Botany· Principles of Inheritance and Variation

    Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

    1. Option A:

      Sutton and Boveri

    2. Option B:

      Alfred STurtevant

    3. Option C:

      Henking

    4. Option D:

      Thomas Hunt Morgan

  95. Question 95Botany· Molecular basis of Inheritance

    Expressed Sequence Tags (ESTs) refers to

    1. Option A:

      All genes that are expressed as proteins

    2. Option B:

      All genes whether expressed or unexpressed.

    3. Option C:

      Certain important expressed genes.

    4. Option D:

      All genes that are expressed as RNA.

  96. Question 96Botany· Molecular basis of Inheritance

    Upon exposure to UV radiation, DNA stained with ethidium bromide will show

    1. Option A:

      Bright blue in colour

    2. Option B:

      Bright yellow colour

    3. Option C:

      Bright orange colour

    4. Option D:

      Bright red colour

  97. Question 97Botany· Respiration in Plants

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)

    Assertion (A): ATP is used at two steps in glycolysis.

    Reason (R): First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6phosphate into fructose-1-6-diphosphate.

    In light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both (A) and (R) are true and (R) is the correct explanation of (A).

    2. Option B:

      Both (A) and (R) are true and (R) is NOT the correct explanation of (A).

    3. Option C:

      (A) is true but (R) is false.

    4. Option D:

      (A) is false but (R) is true.

  98. Question 98Botany· Molecular basis of Inheritance

    Unequivocal proof that DNA is the genetic material was first proposed by

    1. Option A:

      Alfred Hershey and Martha Chase

    2. Option B:

      Avery, MacLeod and McCarty

    3. Option C:

      Wilkins and Franklin

    4. Option D:

      Frederick Griffith

  99. Question 99Botany· Ecosystem

    Identify the correct statements: A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      B, C and D only

    2. Option B:

      C, D and E only

    3. Option C:

      D, E and A only

    4. Option D:

      A, B and C only

  100. Question 100Botany· Photosynthesis in Higher Plants

    The reaction centre in PS II has an absorption maxima at

    1. Option A:

      700 nm

    2. Option B:

      660 nm

    3. Option C:

      780 nm

    4. Option D:

      680 nm

  101. Question 101Botany· Plant Kingdom

    In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

    1. Option A:

      Antipodals, synergids, and primary endosperm nucleus

    2. Option B:

      Synergids, Zygote and Primary endosperm nucleus

    3. Option C:

      Synergids, antipodals and Polar nuclei

    4. Option D:

      Synergids, Primary endosperm nucleus and zygote

  102. Question 102Botany· Cell Cycle and Cell Division

    Which of the following stages of meiosis involves division of centromere?

    1. Option A:

      Metaphase II

    2. Option B:

      Anaphase II

    3. Option C:

      Telophase

    4. Option D:

      Metaphase I

  103. Question 103Botany· Biodiversity and Conservation

    Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?

    1. Option A:

      Over exploitation for economic gain

    2. Option B:

      Alien species invasions

    3. Option C:

      Co-extinctions

    4. Option D:

      Habitat loss and fragmentation

  104. Question 104Botany· Molecular basis of Inheritance

    What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

    1. Option A:

      Transcription of tRNA, 5 srRNA and snRNA

    2. Option B:

      Transcription of precursor of mRNA

    3. Option C:

      Transcription of only snRNAs

    4. Option D:

      Transcription of rRNAs (28S, 18S and 5.8 S)5.8 \mathrm{~S})

  105. Question 105Botany· Anatomy of Flowering Plants

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.

    Statement II: Exarch condition is the most common feature of the root system.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  106. Question 106Botany· Cell Cycle and Cell Division

    The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

    1. Option A:

      pachytene

    2. Option B:

      Diplotene

    3. Option C:

      Diakinesis

    4. Option D:

      Zygotene

  107. Question 107Botany· Plant Kingdom

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)

    Assertion (A): In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.

    Reason (R): Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.

    In light of the above statements, choose the most appropriate answer from the options given below.er from the options given below :

    1. Option A:

      Both (A) and (R) are true and (R) is the correct explanation of (A).

    2. Option B:

      Both (A) and (R) are true and (R) is NOT the correct explanation of (A).

    3. Option C:

      (A) is true but (R) is false.

    4. Option D:

      (A) is false but (R) is true.

  108. Question 108Botany· Plant Kingdom

    Which one of the following statements is NOT correct?

    1. Option A:

      Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.

    2. Option B:

      Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.

    3. Option C:

      The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.

    4. Option D:

      The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms

  109. Question 109Botany· Photosynthesis in Higher Plants

    Which of the following combinations is required for chemiosmosis?

    1. Option A:

      membrane, proton pump, proton gradient, NADP synthase

    2. Option B:

      proton pump, electron gradient, ATP synthase

    3. Option C:

      proton pump, electron gradient, NADP synthase

    4. Option D:

      membrane, proton pump, proton gradient, ATP synthase

  110. Question 110Botany· Cell Cycle and Cell Division

    Match List I with List II :

    List IList II
    A. M PhaseI. Proteins are synthesized
    B. G2G_{2} PhaseII. Inactive phase
    C. Quiescent stageIII. Interval between mitosis and initiation of DNA replication
    D. G1G_{1} PhaseIV. Equational division

    Choose the correct answer from the options given below :

    1. Option A:

      A-IV, B-II, C-I, D-III

    2. Option B:

      A-IV, B-I, C-II, D-III

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-III, B-II, C-IV, D-I

  111. Question 111Botany· Organisms and Populations

    Match List I with List II :

    List IList II
    A. MutualismI. +(A), O(B)
    B. CommensalismII. -(A), O(B)
    C. AmensalismIII. +(A), -(B)
    D. ParasitismIV. +(A), +(B)

    Choose the correct answer from the options given below :

    1. Option A:

      A-IV, B-I, C-II, D-III

    2. Option B:

      A-IV, B-III, C-I, D-II

    3. Option C:

      A-III, B-I, C-IV, D-II

    4. Option D:

      A-IV, B-II, C-I, D-III

  112. Question 112Botany· Organisms and Populations

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.

    Statement II: In general, carnivores are more adversely affected by competition than herbivores.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  113. Question 113Botany· Principles of Inheritance and Variation

    Which of the following statements are correct about Klinefelter's Syndrome?

    A. This disorder was first described by Langdon Down (1866).

    B. Such an individual has overall masculine development. However, the feminine development is also expressed.

    C. The affected individual is short statured.

    D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile.

    Choose the correct answer from the options given below :

    1. Option A:

      C and D only

    2. Option B:

      B and E only

    3. Option C:

      A and E only

    4. Option D:

      A and B only

  114. Question 114Botany· Molecular basis of Inheritance

    How many different proteins does the ribosome consist of?

    1. Option A:

      60

    2. Option B:

      40

    3. Option C:

      20

    4. Option D:

      80

  115. Question 115Botany· Respiration in Plants

    Match List I with List II :

    List IList II
    A. Oxidative decarboxylationI. Citrate synthase
    B. GlycolysisII. Pyruvate dehydrogenase
    C. Oxidative phosphorylationIII. Electron transport system
    D. Tricarboxylic acid cycleIV. EMP pathway

    Choose the correct answer from the options given below :

    1. Option A:

      A-II, B-IV, C-I, D-III

    2. Option B:

      A-III, B-I, C-II, D-IV

    3. Option C:

      A-II, B-IV, C-III, D-I

    4. Option D:

      A-III, B-IV, C-II, D-I

  116. Question 116Botany· Morphology of Flowering Plants

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R).

    Assertion (A): A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem.

    Reason (R): Internodes of the shoot get condensed to produce different floral appendages laterally at successive nodes instead of leaves.

    In light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both A\mathbf{A} and R\mathbf{R} are true but R\mathbf{R} is NOT the correct explanation of A\mathbf{A}.

    2. Option B:

      A\mathbf{A} is true but R\mathbf{R} is false

    3. Option C:

      A\mathbf{A} is false but R\mathbf{R} is true.

    4. Option D:

      Both A\mathbf{A} and R\mathbf{R} are true and R is the correct explanation of A\mathbf{A}.

  117. Question 117Botany· Molecular basis of Inheritance

    Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.

    A. Insertion of recombinant DNA into the host cell.

    B. Cutting of DNA at specific location by restriction enzyme.

    C. Isolation of desired DNA fragment.

    D. Amplification of gene of interest using PCR.

    Choose the correct answer from the options given below :

    1. Option A:

      C,A,B,D\mathrm{C}, \mathrm{A}, \mathrm{B}, \mathrm{D}

    2. Option B:

      C,B,A,D

    3. Option C:

      B,D,A,C\mathrm{B}, \mathrm{D}, \mathrm{A}, \mathrm{C}

    4. Option D:

      B,C,D,AB, C, D, A

  118. Question 118Zoology· Human Reproduction

    Which of the following statements are correct regarding female reproductive cycle?

    A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.

    B. First menstrual cycle begins at puberty and is called menopause.

    C. Lack of menstruation may be indicative of pregnancy.

    D. Cyclic menstruation extends between menarche and menopause.

    Choose the most appropriate answer from the options given below:

    1. Option A:

      A and B only

    2. Option B:

      A, B and C only

    3. Option C:

      A, C and D only

    4. Option D:

      A and D only

  119. Question 119Zoology· Breathing and Exchange of Gases

    Vital capacity of lung is___

    1. Option A:

      IRV + ERV + TV + RV

    2. Option B:

      IRV + ERV + TV - RV

    3. Option C:

      IRV + ERV + TV

    4. Option D:

      IRV + ERV

  120. Question 120Zoology· Reproductive Health

    Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

    1. Option A:

      Gonorrhoea

    2. Option B:

      Hepatitis-B

    3. Option C:

      HIV Infection

    4. Option D:

      Genital herpes

  121. Question 121Zoology· Chemical Control and Coordination

    Match List I with List II.

    List IList II
    A. CCKI. Kidney
    B. GIPII. Heart
    C. ANFIII. Gastric gland
    D. ADHIV. Pancreas

    Choose the correct answer from the options given below:

    1. Option A:

      A-III, B-II, C-IV, D-I

    2. Option B:

      A-II, B-IV, C-I, D-III

    3. Option C:

      A-IV, B-II, C-III, D-I

    4. Option D:

      A-IV, B-III, C-II, D-I

  122. Question 122Zoology· Human Health and Diseases

    Match List I with List II. List I List II

    List IList II
    A. RingwormI. Haemophilus influenzae
    B. FilariasisII. Trichophyton
    C. MalariaIII. Wuchereria bancrofti
    D. PneumoniaIV. Plasmodium vivax

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-III, C-I, D-IV

    2. Option B:

      A-III, B-II, C-I, D-IV

    3. Option C:

      A-III, B-II, C-IV, D-I

    4. Option D:

      A-II, B-III, C-IV, D-I

  123. Question 123Zoology· Body Fluids and Circulation

    Match List I with List II.

    List IList II
    A. P - waveI. Beginning of systole
    B. Q - waveII. Repolarisation of ventricles
    C. QRS complexIII. Depolarisation of atria
    D. T - waveIV. Depolarisation of ventricles

    Choose the correct answer from the options given below:

    1. Option A:

      A-IV, B-III, C-II, D-I

    2. Option B:

      A-II, B-IV, C-I, D-III

    3. Option C:

      A-I, B-II, C-III, D-IV

    4. Option D:

      A-III, B-I, C-IV, D-II

  124. Question 124Zoology· Human Health and Diseases

    In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

    1. Option A:

      B-lymphocytes

    2. Option B:

      Basophils

    3. Option C:

      Eosinophils

    4. Option D:

      TH\mathrm{T}_{\mathrm{H}} cells

  125. Question 125Zoology· Biomolecules

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.

    Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  126. Question 126Zoology· Biomolecules

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid ( N -terminal)

    Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α\alpha type and two subunits of β\beta type.)

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statements I and II are incorrect.

    2. Option B:

      Statement I is correct and Statement II is incorrect.

    3. Option C:

      Statement I is incorrect and Statement II is correct.

    4. Option D:

      Both statements I and II are correct.

  127. Question 127Zoology· Excretory Products and their Elimination

    Match List I with List II.

    List IList II
    A. TaeniaI. Nephridia
    B. ParamoeciumII. Contractile vacuole
    C. PeriplanetaIII. Flame cells
    D. PheretimaIV. Urecose gland

    Choose the correct answer from the options give below:

    1. Option A:

      A-I, B-II, C-IV, D-III

    2. Option B:

      A-III, B-II, C-IV, D-I

    3. Option C:

      A-II, B-I, C-IV, D-III

    4. Option D:

      A-I, B-II, C-III, D-IV

  128. Question 128Zoology· Human Reproduction

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.

    Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are incorrect.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  129. Question 129Zoology· Animal Kingdom

    Radial symmetry is NOT found in adults of phylum___

    1. Option A:

      Hemichordata

    2. Option B:

      Coelenterata

    3. Option C:

      Echinodermata

    4. Option D:

      Ctenophora

  130. Question 130Botany· Cell: The Unit of Life

    Which of the following functions is carried out by cytoskeleton in a cell?

    1. Option A:

      Protein synthesis

    2. Option B:

      Motility

    3. Option C:

      Transportation

    4. Option D:

      Nuclear division

  131. Question 131Zoology· Reproductive Health

    Match List I with List II. List I

    List IList II
    A. VasectomyI. Oral method
    B. Coitus interruptusII. Barrier method
    C. Cervical capsIII. Surgical method
    D. SaheliIV. Natural method

    Choose the correct answer from the options given below:

    1. Option A:

      A-III, B-IV, C-II, D-I

    2. Option B:

      A-II, B-III, C-I, D-IV

    3. Option C:

      A-IV, B-II, C-I, D-III

    4. Option D:

      A-III, B-I, C-IV, D-II

  132. Question 132Zoology· Locomotion and Movement

    Match List I with List II.

    List I (Type of Joint)List II (Found between)
    A. Cartilaginous JointI. Between flat skull bones
    B. Ball and Socket JointII. Between adjacent vertebrae in vertebral column
    C. Fibrous JointIII. Between carpal and metacarpal of thumb
    D. Saddle JointIV. Between Humerus and Pectoral girdle

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-IV, C-I, D-III

    2. Option B:

      A-I, B-IV, C-III, D-II

    3. Option C:

      A-II, B-IV, C-III, D-I

    4. Option D:

      A-I, B-III, C-IV, D-II

  133. Question 133Zoology· Human Health and Diseases

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: RNA mutates at a faster rate.

    Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are correct.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are correct.

  134. Question 134Botany· Molecular basis of Inheritance

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

    Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are false.

    2. Option B:

      Statement I is true but Statement II is false.

    3. Option C:

      Statement I is false but Statement II is true

    4. Option D:

      Both Statement I and Statement II are true.

  135. Question 135Zoology· Evolution

    Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

    1. Option A:

      Numbat, Spotted cuscus, Flying phalanger

    2. Option B:

      Mole, Flying squirrel, Tasmanian tiger cat

    3. Option C:

      Lemur, Anteater, Wolf

    4. Option D:

      Tasmanian wolf, Bobcat, Marsupial mole

  136. Question 136Zoology· Biotechnology: Principles and Processes

    Which of the following is not a cloning vector?

    1. Option A:

      YAC

    2. Option B:

      pBR322

    3. Option C:

      probe

    4. Option D:

      BAC

  137. Question 137Zoology· Human Health and Diseases

    Match List I with List II.

    List IList II
    A. HeroinI. Effect on cardiovascular system
    B. MarijuanaII. Slow down body function
    C. CocaineIII. Painkille
    D. MorphineIV. Interfere with transport of dopamine

    Choose the correct answer from the options given below:

    1. Option A:

      A-I, B-II, C-III, D-IV

    2. Option B:

      A-IV, B-III, C-II, D-I

    3. Option C:

      A-III, B-IV, C-I, D-II

    4. Option D:

      A-II, B-I, C-IV, D-III

  138. Question 138Zoology· Biotechnology and its Applications

    Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

    1. Option A:

      Serum and urine analysis

    2. Option B:

      Polymerase Chain Reaction (PCR) technique

    3. Option C:

      Enzyme Linked Immuno-Sorbent Assay (ELISA) technique

    4. Option D:

      Recombinant DNA Technology

  139. Question 139Zoology· Human Reproduction

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)

    Assertion A: Endometrium is necessary for implantation of blastocyst.

    Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.

    In light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both A\mathbf{A} and R\mathbf{R} are true but R\mathbf{R} is NOT the correct explanation of A\mathbf{A}.

    2. Option B:

      A\mathbf{A} is true but R\mathbf{R} is false.

    3. Option C:

      A\mathbf{A} is false but R\mathbf{R} is true.

    4. Option D:

      Both A\mathbf{A} and R\mathbf{R} are true and R\mathbf{R} is the correct explanation of A\mathbf{A}.

  140. Question 140Botany· Molecular basis of Inheritance

    Match List I with List II.

    List IList II
    A. Gene ‘ aa ’I. β\beta-galactosidase
    B. Gene ' yy 'II. Transacetylase
    C. Gene ' ii 'III. Permease
    D. Gene ' zz 'IV. Repressor protein

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-III, C-IV, D-I

    2. Option B:

      A-III, B-IV, C-I, D-II

    3. Option C:

      A-III, B-I, C-IV, D-II

    4. Option D:

      A-II, B-I, C-IV, D-III

  141. Question 141Zoology· Excretory Products and their Elimination

    Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)

    Assertion (A): Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.

    Reason (R): Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.

    In light of the above statements, choose the most appropriate answer from the options given below.

    1. Option A:

      Both A\mathbf{A} and R\mathbf{R} are true but R\mathbf{R} is NOT the correct explanation of A\mathbf{A}.

    2. Option B:

      A\mathbf{A} is true but R\mathbf{R} is false.

    3. Option C:

      A\mathbf{A} is false but R\mathbf{R} is true.

    4. Option D:

      Both A\mathbf{A} and R\mathbf{R} are true and R\mathbf{R} is the correct explanation of A\mathbf{A}.

  142. Question 142Botany· Cell Cycle and Cell Division

    Select the correct statements.

    A. Tetrad formprsenceation is seen during Leptotene.

    B. During Anaphase, the centromeres split and chromatids separate.

    C. Terminalization takes place during Pachytene.

    D. Nucleolus, Golgi complex and ER are reformed during Telophase.

    E. Crossing over takes place between sister chromatids of homologous chromosome.

    Choose the correct answer from the options given below:

    1. Option A:

      B and D only

    2. Option B:

      A, C and E only

    3. Option C:

      B and E only

    4. Option D:

      A and C only

  143. Question 143Zoology· Excretory Products and their Elimination

    Which of the following statements are correct?

    A. An excessive loss of body fluid from the body switches off osmoreceptors.

    B. ADH facilitates water reabsorption to prevent diuresis.

    C. ANF causes vasodilation.

    D. ADH causes increase in blood pressure.

    E. ADH is responsible for decrease in GFR.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      B,C and D only

    2. Option B:

      A, B and E only

    3. Option C:

      C,D and E only

    4. Option D:

      A and B only

  144. Question 144Botany· Cell Cycle and Cell Division

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: During G0\mathrm{G}_{0} phase of cell cycle, the cell is metabolically inactive.

    Statement II: The centrosome undergoes duplication during SS phase of interphase.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both statement I and statement Il are correct.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are incorrect.

  145. Question 145Botany· Ecosystem

    Match List I with List II.

    List IList II
    A. Logistic growthI. Unlimited resource availability condition
    B. Exponential growthII. Limited resource availability condition I
    C. Expanding age pyramidIII. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
    D. Stable age pyramidIV. The percent individuals of pre-reproductives and reproductive age group are same

    Choose the correct answer from the options given below:

    1. Option A:

      A-II, B-III, C-I, D-IV

    2. Option B:

      A-II, B-IV, C-I, D-III

    3. Option C:

      A-II, B-IV, C-III, D-I

    4. Option D:

      A-II, B-I, C-III, D-IV

  146. Question 146Zoology· Chemical Control and Coordination

    Which of the following are NOT under the control of thyroid hormone?

    A. Maintenance of water and electrolyte balance

    B. Regulation of basal metabolic rate

    C. Normal rhythm of sleep-wake cycle

    D. Development of immune system

    E. Support the process of R.B.Cs formation

    Choose the correct answer from the options given below:

    1. Option A:

      B and C only

    2. Option B:

      C and D only

    3. Option C:

      D and E only

    4. Option D:

      A and D only

  147. Question 147Zoology· Animal Kingdom

    The unique mammalian characteristics are:

    1. Option A:

      pinna and mammary glands

    2. Option B:

      hairs, pinna and indirect developement

    3. Option C:

      pinna, monocondylic skull and mammary glands

    4. Option D:

      hairs, tympanic membrane and mammary glands

  148. Question 148Zoology· Locomotion and Movement

    Which of the following statements are correct regarding skeletal muscle?

    A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.

    B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.

    C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.

    D. M line is considered as functional unit of contraction called sarcomere.

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      B and C only

    2. Option B:

      A, C and D only

    3. Option C:

      C and D only

    4. Option D:

      A, B and C only

  149. Question 149Zoology· Body Fluids and Circulation

    Which of the following statements are correct ?

    A. Basophils are most abundant cells of the total WBCs

    B. Basophils secrete histamine, serotonin and heparin

    C. Basophils are involved in inflammatory response

    D. Basophils have kidney shaped nucleus

    E. Basophils are agranulocytes

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      C and E only

    2. Option B:

      B and C only

    3. Option C:

      A and B only

    4. Option D:

      D and E only

  150. Question 150Zoology· Neural Control and Coordination

    The parts of the human brain that help in the regulation of sexual behaviour, expression of excitement, pleasure, rage, fear, etc. are:

    1. Option A:

      corpora quadrigemina and hippocampus

    2. Option B:

      Brain stem & epithalamus

    3. Option C:

      Corpus callosum and thalamus

    4. Option D:

      Limbic system & hypothalamus

  151. Question 151Zoology· Animal Kingdom

    Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      B and C only

    2. Option B:

      B, D and E only

    3. Option C:

      C, D and E only

    4. Option D:

      A, C and D only

  152. Question 152Physics· Semiconductor and Electronic Devices

    In half wave rectification, if the input frequency is 60 Hz , then the output frequency would be

    1. Option A:

      120 Hz

    2. Option B:

      Zero

    3. Option C:

      30 Hz

    4. Option D:

      60 Hz

  153. Question 153Botany· Transport in plant

    Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

    1. Option A:

      Facilitated Diffusion

    2. Option B:

      Passive Transport

    3. Option C:

      Active Transport

    4. Option D:

      Osmosis

  154. Question 154Botany· Anatomy of Flowering Plants

    Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :

    Assertion A : Late wood has fewer xylary elements with narrow vessels.

    Reason R : Cambium is less active in winters.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      Both A and R are true but R is NOT the correct explanation of A

    2. Option B:

      A is true but R is false

    3. Option C:

      A is false but R is true

    4. Option D:

      Both A and R are true and R is the correct explanation of A

  155. Question 155Botany· Transport in plant

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters height.

    Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.

    In the light of the above statements, choose the most appropriate answer from the options given below :

    1. Option A:

      Both Statement I and Statement II are incorrect

    2. Option B:

      Statement I is correct but Statement II is incorrect

    3. Option C:

      Statement I is incorrect but Statement II is correct

    4. Option D:

      Both Statement I and Statement II are correct

  156. Question 156Botany· Mineral Nutrition

    Which micronutrient is required for splitting of water molecule during photosynthesis?

    1. Option A:

      Molybdenum

    2. Option B:

      Magnesium

    3. Option C:

      Copper

    4. Option D:

      Manganese

  157. Question 157Botany· Mineral Nutrition

    Match List I with List II: Choose the correct answer from the options given below:

    List IList II
    I. IronSynthesis of auxin
    II. ZincComponent of nitrate reductase
    III. BoronActivator of catalase
    IV. MolybdenumCell elongation and differentiation
    1. Option A:

      A-II, B-III, C-IV, D-I

    2. Option B:

      A-III, B-I, C-IV, D-II

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-III, B-II, C-I, D-IV

  158. Question 158Botany· Anatomy of Flowering Plants

    Identify the correct statements:

    A. Lenticels are the lens-shaped openings permitting the exchange of gases.

    B. Bark formed early in the season is called hard bark.

    C. Bark is a technical term that refers to all tissues exterior to vascular cambium.

    D. Bark refers to periderm and secondary phloem.

    E. Phellogen is single-layered in thickness.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      A and D only

    2. Option B:

      A, B and D only

    3. Option C:

      B and C only

    4. Option D:

      B, C and E only

  159. Question 159Botany· Microbes in Human Welfare

    Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

    1. Option A:

      Amylase

    2. Option B:

      Lipase

    3. Option C:

      Dinitrogenase

    4. Option D:

      Succinic dehydrogenase

  160. Question 160Botany· Organisms and Populations

    Match List I with List II.Choose the correct answer from the options given below.

    List I (Interacting species)List II (Name of interaction)
    A. A Leopard and a Lion in a forest/grasslandI. Competition
    B. A Cuckoo laying egg in a Crow’s nestII. Brood parasitism
    C. Fungi and root of a higher plant in MycorrhizaeIII. Mutualism
    D. A cattle egret and a Cattle in a fieldIV. Commensalism
    1. Option A:

      A-I, B-II, C-IV, D-III

    2. Option B:

      A-III, B-IV, C-I, D-II

    3. Option C:

      A-II, B-III, C-I, D-IV

    4. Option D:

      A-I, B-II, C-III, D-IV

  161. Question 161Zoology· Structural Organisation in Animals

    Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

    1. Option A:

      Presence of anal styles

    2. Option B:

      Presence of sclerites

    3. Option C:

      Presence of anal cerci

    4. Option D:

      Dark brown body colour and anal cerci

  162. Question 162Zoology· Biomolecules

    Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

    1. Option A:

      3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’

    2. Option B:

      5’ ATCGATCGATCGATCGATCGATCGATCG 3’

    3. Option C:

      3’ ATCGATCGATCGATCGATCGATCGATCG 5’

    4. Option D:

      5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’

  163. Question 163Zoology· Structural Organisation in Animals

    Match List I with List II.Choose the correct answer from the options give below:

    List IList II
    A. Mast cellsI. Ciliated epithelium
    B. Inner surface of bronchioleII. Areolar connective tissue
    C. BloodIII. Cuboidal epithelium
    D. Tubular parts of nephronIV. Specialised connective tissue
    1. Option A:

      A-II, B-III, C-I, D-IV

    2. Option B:

      A-II, B-I, C-IV, D-III

    3. Option C:

      A-III, B-IV, C-II, D-I

    4. Option D:

      A-I, B-II, C-IV, D-III

  164. Question 164Zoology· Structural Organisation in Animals

    In cockroach, excretion is brought about by: A. Phallic gland B. Uricose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:

    1. Option A:

      A, B and E only

    2. Option B:

      B, C and D only

    3. Option C:

      B and D only

    4. Option D:

      A and E only

  165. Question 165Botany· Biotechnology

    In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as

    1. Option A:

      Dedifferentiation

    2. Option B:

      Development

    3. Option C:

      Senescence

    4. Option D:

      Differentiation

  166. Question 166Chemistry· Environmental Chemistry

    The thickness of ozone in a column of air in the atmosphere is measured in terms of :

    1. Option A:

      Decibels

    2. Option B:

      Decameter

    3. Option C:

      Kilobase

    4. Option D:

      Dobson units

  167. Question 167Zoology· Biomolecules

    Cellulose does not form blue colour with Iodine because

    1. Option A:

      It is a helical molecule

    2. Option B:

      It does not contain complex helices and hence cannot hold iodine molecules

    3. Option C:

      It breakes down when iodine reacts with it

    4. Option D:

      It is a disaccharide

  168. Question 168Botany· Transport in plant

    Match List I with List II :

    List IList II
    A. CohesionI. More attraction in liquid phase
    B. AdhesionII. Mutual attraction among water molecules
    C. Surface tensionIII. Water loss in liquid phase
    D. GuttationIV. Attraction towards polar surfaces
    1. Option A:

      A – IV, B – III, C – II, D – I

    2. Option B:

      A – III, B – I, C – IV, D – II

    3. Option C:

      A – II, B – I, C – IV, D – III

    4. Option D:

      A – II, B – IV, C – I, D – III

  169. Question 169Zoology· Structural Organisation in Animals

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Ligaments are dense irregular tissue.

    Statement II: Cartilage is dense regular tissue.

    In the light of the above statements, choose the correct answer from the options given below:

    1. Option A:

      Both statement I and statement Il are correct.

    2. Option B:

      Statement I is correct and statement Il is incorrect.

    3. Option C:

      Statement I is incorrect and statement Il is correct.

    4. Option D:

      Both statements 1 and statements ll are incorrect.

  170. Question 170Botany· Principles of Inheritance and Variation

    Broad palm with single palm crease is visible in a person suffering from-

    1. Option A:

      Turner’s syndrome

    2. Option B:

      Klinefelter’s syndrome

    3. Option C:

      Thalassemia

    4. Option D:

      Down’s syndrome

  171. Question 171Botany· NEET 2024 Deleted Syllabus

    Which of the following statements is correct?

    1. Option A:

      Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.

    2. Option B:

      Presence of large amount of nutrients in water restricts ‘Algal Bloom’

    3. Option C:

      Algal Bloom decreases fish mortality

    4. Option D:

      Eutrophication refers to increase in domestic sewage and waste water in lakes.

  172. Question 172Botany· NEET 2024 Deleted Syllabus

    Given below are two statements : one is labelled as Statement I and the other is labelled as Statement II :

    Statement I: Electrostatic precipitator is most widely used in thermal power plant .

    Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations .

    In the light of the above statements, choose the most appropriate answer from the options given below:

    1. Option A:

      Both Statement I and Statement II are incorrect.

    2. Option B:

      Statement I is correct but Statement II is incorrect.

    3. Option C:

      Statement I is incorrect but Statement II is correct.

    4. Option D:

      Both Statement I and Statement II are correct.

  173. Question 173Zoology· Digestion and absorption

    Match List I with List II

    List I (Cells)List II (Secretion)
    A. Peptic cellsI. Mucus
    B. Goblet cellsII. Bile juice
    C. Oxyntic cellsIII. Proenzyme pepsinogen
    D. Hepatic cellsIV. HCl and intrinsic factor for absorption of vitamin B12\mathrm{B}_{12}
    1. Option A:

      A-II, B-I, C-III, D-IV

    2. Option B:

      A-III, B-I, C-IV, D-II

    3. Option C:

      A-II, B-IV, C-I, D-III

    4. Option D:

      A-IV, B-III, C-II, D-I

  174. Question 174Zoology· NEET 2024 Deleted Syllabus

    Match List I with List II with respect to human eye.

    List IList II
    A. FoveaI. Visible coloured portion of eye that regulates diameter of pupil.
    B. IrisII. External layer of eye formed of dense connective tissue.
    C. Blind spotIII. Point of greatest visual acuity or resolution.
    D. ScleraIV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent
    1. Option A:

      A-IV, B-III, C-II, D-I

    2. Option B:

      A-I, B-IV, C-III, D-II

    3. Option C:

      A-II, B-I, C-III, D-IV

    4. Option D:

      A-III, B-I, C-IV, D-II

  175. Question 175Zoology· Digestion and absorption

    Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by

    1. Option A:

      Ileo-caecal valve

    2. Option B:

      Gastro-oesophageal sphincter

    3. Option C:

      Pyloric sphincter

    4. Option D:

      Sphincter of Oddi

  176. Question 176Physics· Semiconductor and Electronic Devices

    A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

    1. Option A:

      p-n junction diodes

    2. Option B:

      Capacitor

    3. Option C:

      Load resistance

    4. Option D:

      A centre-tapped transformer

  177. Question 177Physics· Thermodynamics

    A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is

    1. Option A:

      15°C

    2. Option B:

      100°C

    3. Option C:

      200°C

    4. Option D:

      27°C

  178. Question 178Chemistry· Alkaline Earth Metals - Group 2

    Taking stability as the factor, which one of the following represents correct relationship?

    1. Option A:

      ∣n∣3>∣n∣|n|_3>|n|

    2. Option B:

      AlCl>AlCl3\mathrm{AlCl}>\mathrm{AlCl}_3

    3. Option C:

      TℓI>Tℓl3\mathrm{T} \ell \mathrm{I}>\mathrm{T} \ell l_3

    4. Option D:

      TℓCl3>TℓCl\mathrm{T} \ell \mathrm{Cl}_3>\mathrm{T} \ell \mathrm{Cl}

  179. Question 179Chemistry· Hydrogen and its Compounds

    Which of the following statements are NOT correct?

    A. Hydrogen is used to reduce heavy metal oxides to metals.

    B. Heavy water is used to study reaction mechanism.

    C. Hydrogen is used to make saturated fats from oils.

    D. The H–H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any elements.

    E. Hydrogen reduces oxides of metals that are more active than iron.

    Choose the most appropriate answer from the options given below:

    1. Option A:

      B, D only

    2. Option B:

      D, E only

    3. Option C:

      A, B, C only

    4. Option D:

      B, C, D, E only

  180. Question 180Chemistry· Biomolecules

    Given below are two statements : one is labelled as Statement 1 and the other is labelled as Statement 2 :

    Statement I : A unit formed by the attachment of a base to 1′ position of sugar is known as nucleoside.

    Statement II : When nucleoside is linked to phosphorous acid at 5′ -position of sugar moiety, we get nucleotide.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      Both Statement I and Statement II are false

    2. Option B:

      Statement I is true but Statement II is false

    3. Option C:

      Statement I is false but Statement II is true

    4. Option D:

      Both Statement I and Statement II are true

  181. Question 181Chemistry· Alkali Metals - Group 1

    Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R\mathbf{R} :

    Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.

    Reason R\mathbf{R} : The deep blue solution is due to the formation of amide.

    In the light of the above statements, choose the correct answer from the options given below :

    1. Option A:

      Both A and R are true but R is NOT the correct explanation of A

    2. Option B:

      A is true but R is false

    3. Option C:

      A is false but R is true

    4. Option D:

      Both A and R are true and R is the correct explanation of A

  182. Question 182Chemistry· Thermodynamics & Thermochemistry

    The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :

    1. Option A:

      FeO+CO→Fe+CO2\mathrm{FeO}+\mathrm{CO} \rightarrow \mathrm{Fe}+\mathrm{CO}_2

    2. Option B:

      C+CO2→2CO\mathrm{C}+\mathrm{CO}_2 \rightarrow 2 \mathrm{CO}

    3. Option C:

      CaO+SiO2→CaSiO3\mathrm{CaO}+\mathrm{SiO}_2 \rightarrow \mathrm{CaSiO}_3

    4. Option D:

      Fe2O3+CO→2FeO+CO2\mathrm{Fe}_2 \mathrm{O}_3+\mathrm{CO} \rightarrow 2 \mathrm{FeO}+\mathrm{CO}_2

  183. Question 183Chemistry· Surface Chemistry

    Pumice stone is an example of

    1. Option A:

      Gel

    2. Option B:

      Solid sol

    3. Option C:

      Foam

    4. Option D:

      Sol

  184. Question 184Botany· Plant Growth and Development

    Which hormone promotes internode/petiole elongation in deep water rice?

    1. Option A:

      Kinetin

    2. Option B:

      Ethylene

    3. Option C:

      2, 4-D

    4. Option D:

      GA3GA_3

  185. Question 185Botany· Cell: The Unit of Life

    Which of the following are NOT considered as the part of endomembrane system?

    A. Mitochondria

    B. Endoplasmic Reticulum

    C. Chloroplasts

    D. Golgi complex

    E. Peroxisomes

    Choose the most appropriate answer from the options given below:

    1. Option A:

      A, C and E only

    2. Option B:

      A and D only

    3. Option C:

      A, D and E only

    4. Option D:

      B and D only

Stuck on one of these?

Practise questions like them — free, with a tutor that explains every step.